by Kōji Suzuki
 As Kaoru entered his father's hospital room, he found Professor Saiki just getting up from the chair by his father's bed.
   "Hey," Saiki said on seeing Kaoru. He raised a hand and made as if to leave the room.
   "That's alright, stay a while." If he was leaving because he felt bad about disrupting Kaoru's visit with his father, then Kaoru felt a duty to press him to stay.
   "I can't. As you know, I'm quite busy." And it didn't seem like mere politeness: Saiki was twitching as if he did indeed have pressing business.
   "Oh. Well, then."
   "That's right. I just popped in by special request," Saiki said, glancing at Hideyuki. Then he raised his hand again, said, "Later, then," and left. Kaoru watched him walk away, then went to his father's side.
   "How are you feeling, Dad?"
   Kaoru gazed down at his father for a moment, studying his color and the set of his jaw, before taking Saiki's place in the chair.
   "Annoyed," Hideyuki said in a monotone, eyes raised to the ceiling.
   "What happened?".
   "Saiki. He brings nothing but bad news."
   Saiki was an old classmate from med school, but as he'd elected to go into research rather than clinical medicine, he wasn't directly involved in Hideyuki's case. Which made Kaoru wonder all the more what sort of bad news he could have been bringing.
   "What do you mean?"
   "Do you know Masato Nakamura?"
   Hideyuki's voice was hoarse.
   "One of your friends, right?"
   Kaoru recognized the name Nakamura. He'd been a coworker of Hideyuki's on the Loop project; Kaoru believed he was currently a professor in the engineering department of a provincial university.
   "He's dead," said Hideyuki, curtly.
   "Really?"
   "He had the same illness as me."
   Kaoru had heard people say that when someone your own age dies it invariably comes as a shock, making you feel it might be your turn next.
   "You're still alright, Dad."
   Kaoru couldn't think of anything to say that didn't sound commonplace. Hideyuki slowly shook his head where he lay, as if to say that meaningless words of encouragement wouldn't do him any good.
   "Do you know Komatsuzaki?"
   "No." Kaoru had never heard this name.
   "He joined the Loop project after me."
   "Oh?"
   "He's dead, too."
   Kaoru swallowed hard. Death's shadow was creeping ever closer to his father.
   Hideyuki proceeded to list three more names, summing up with a simple "They're all dead."
   "Doesn't it make you wonder what's going on?" he continued. "All those names I mentioned belonged to people I worked with on the artificial life project, or who were at least connected with it in some way."
   "And all of them died from MHC?"
   "How many people in Japan have been infected with this virus?"
   "About a million, maybe?" That included people like Reiko and Kaoru's mother who had been infected but hadn't yet gotten sick.
   "That's a whole lot, but it's still no more than one percent of the population. Whereas, me, I don't know anybody who's not infected."
   Hideyuki cast a sharp glance at Kaoru; at first he seemed to be searching Kaoru's soul, but then his expression relaxed into one of prayer.
   "You're okay, right?"
   Hideyuki brought a hand out from under his sheet and touched Kaoru's knee through his jeans. No doubt he wanted to hold his son's hand, but was afraid of skin-on-skin contact. With his wife already infected, all it would take to rob Hideyuki of the will to fight the cancer would be knowing that Kaoru had contracted the virus too.
   Kaoru averted his eyes from his father's weakening gaze.
   "Were there any problems with the test results?"
   Kaoru felt like his father could look right through him, but he forced himself to speak through his fear. "I told you there's nothing to worry about." True, two months ago his test results had been negative, but there was no telling what next month's test would reveal.
   Kaoru turned away, pretending to be reacting to the sound of footsteps in the corridor. He flashed back to the scene in Ryoji's room yesterday afternoon; the mental images brought with them stirrings of the blood and of the flesh, resurrecting the sensory fluctuations that had rocked his body.
   The evening before last, he'd been forced to limit his contact with Reiko to kissing. They'd been in a hallway, and they'd only been vouchsafed a few minutes. Considering they were in a hospital, it was about as much as they had any right to hope for.
   The next afternoon-yesterday-he'd gone back to Ryoji's sickroom to retrieve the pathology textbook he'd left there, and he arrived just after Ryoji had been taken off to Radiology for some tests. Kaoru hadn't known it was time for his tests; Reiko hadn't told him. But to all appearances it looked as if he'd timed his visit to coincide with the boy's absence.
   He knocked softly, and immediately Reiko opened the door, but just a crack. Her face was wet and she was holding a towel-she must have been washing her face when he knocked. There was a sink next to the door, and the ten-watt fluorescent bulb above it was lit. She'd been taking off her makeup there, rather than in the bathroom.
   Patting her face with the towel, she spoke in a quiet, controlled voice.
   "You forgot something yesterday."
   "Sorry, I should have called first." Kaoru lowered his voice in response. There was no sign of Ryoji.
   "Come in."
   She took his hand and guided him into the room, then shut the door. They stood in front of the sink, in front of the mirror, facing each other. She finished wiping her face. She was letting Kaoru see her features unadorned by cosmetics.
   There were crows' feet around her eyes, appropriate to her age, but they only made her look more attractive to him.
   A partition stood between them and Ryoji's empty bed; Kaoru nodded toward it, as if to ask why he wasn't in it.
   "The nurse just took him away."
   "Tests?"
   "Yes."
   "What kind?" "
   "A scintigram," she said in a shaky tone that suggested she was unfamiliar with the word.
   A scintigram, a precursor to chemotherapy, took two hours at a minimum, since it involved injecting a contrast medium into the subject's veins. Nobody would be coming in until the test was finished. For that brief interval, Reiko and Kaoru had been left with a private room all to themselves.
   With Ryoji's test regimen reaching this point, Reiko found herself face to face with the prospect of her son entering chemotherapy. She was dejected. A bitter battle was beginning. Anti-cancer drugs harm normal cells in the process of attacking cancer cells. She knew she'd have to watch her son suffer from lethargy, loss of appetite, nausea, and the prospect hurt her more than anything, especially as she knew that his enduring this suffering wouldn't guarantee the extinction of his cancer cells. All it would do would be to slow their rate of reproduction, and thereby delay the final moments. This cancer was destined to metastasize, and there was no way to prevent it.
   Kaoru didn't know what to say to this mother whose son had been taken away from her. Platitudes would only make it worse.
   But Reiko looked him in the eye and said, "The miracle will come if we wait for it."
   She enfolded Kaoru's hands in hers; it seemed to be a habit of hers.
   "I just don't know."
   "I'm sick and tired of living like this."
   "Me, too."
   "Well, do something! Please! Help us! I know you can."
   Like I can do anything! Kaoru felt like screaming, but managed to keep himself from saying anything.
   Reiko's bangs were still wet and several strands clung to her forehead. Beneath them her eyes were moist and pleading. Her mouth quivered as if she might break out into sobs at any moment; Kaoru's heart went out to her. If only he could help. He wanted to, badly. He couldn't stand by helplessly and watch this magnificent body laid low.
   The faucet next to them hadn't been shut off all the way-a lit
tle trickle of water came out of it. The sound filled the room and stimulated his desire. The noise of the water itself was what urged him into action.
   Reiko looked at the faucet, and tried to free one hand to turn it off. But Kaoru only gripped her hand tighter, pulling her toward him with great force.
   At first she made as if to resist, a complex series of emotions clouding her features. Conflicting feelings raged within her-Kaoru knew this by the touch of her skin. Her obligations as a mother, and her desires as a woman.
   Still holding her to him, he shifted positions and tried to lay her down on the bed. But she resisted slightly, so that she ended up sitting on the floor with her back pushed up against the edge of the bed.
   Pinned against a sickbed missing its owner, hunched over with death a burden on her shoulders, Reiko tried to confront the sexual impulses pressing in on her. The spectre of death was assaulting her from everywhere, except the direction from which lust came, boiling up as if to prove that she was still alive. Then she thought of how her son at this very moment was undergoing cruel tests, and the knowledge enervated her desire. Her maternal instincts began to crowd out her sexual needs.
   But not Kaoru. He was beyond reining in now, as his mind and body came together in pursuit of a single goal.
   He didn't care that Reiko was infected with MHC. He was aware of the data showing that the virus spread even more easily through genital contact than oral, but for the moment that knowledge was clean gone from him.
   He sat down next to her, intertwined with her, on the floor of the sickroom. He placed his mouth over hers, nimbly undid the buttons of her blouse. These bold, play boyish actions surprised even him: he was relatively inexperienced at romance.
   While Kaoru basked in his memories of the previous afternoon, Hideyuki obstinately hammered away on the dangers of exposing oneself to the virus.
   … Your blood test came back negative? … I was your age once-you 've got to be careful with women… You can't let yourself get careless… Don't give in to momentary temptation…
   The words went right over Kaoru's head. He couldn't look his father in the eye. The pure, simple act of loving a woman had become a betrayal of his father's expectations.
   "Hey, kiddo! Are you listening to me?"
   Hideyuki threw a monkey wrench into the workings of Kaoru's reverie. It had been ages since he'd called Kaoru "kiddo". Kaoru gradually let himself be pulled back to the present moment.
   "Don't worry, I said."
   Hideyuki still showed no signs of softening his suspicious gaze.
   They stared at each other in silence for a while.
   They exchanged more information that way than they'd been able to communicate in words. Then Hideyuki reached out and touched Kaoru's knee once more.
   "Don't you get it? You're my greatest treasure."
   Kaoru placed his hand over his father's.
   "I know, Dad."
   "I don't want you giving in to this. You've got to fight it. You've got to concentrate all your intelligence on confronting this enemy that wants to destroy your body, your youth."
   Reiko was imploring him to help; his father was ordering him to fight. He felt pressure from both sides. But if he had been infected with MHC, if he was at risk of developing metastatic cancer, then those imperatives would cease to be things external to him. He'd have to rouse himself to action in order to protect his own body.
   Hideyuki returned to his previous topic. "When Saiki was here he was telling me how all my old colleagues were succumbing to this disease, one after the other, and it struck me. I know a lot of cancer victims."
   "I guess so," Kaoru grunted. He, too, knew a lot of carriers of the MHC virus.
   "Maybe there's a reason."
   "Like, maybe researchers are particularly susceptible?"
   "This should be right up your alley. You're the one who ferreted out those longevity zones from the gravitational anomaly map. Listen to me. I want you to make a distribution map of people with MHC in Japan and America. Or a breakdown of infected people by occupation. Anyway, just gather all the data you can and come up with some statistics."
   "Okay. I'll give it a try."
   "I've got a feeling about this. I don't think it's a coincidence that we have so much sickness around us."
   Still looking up at the ceiling, Hideyuki stretched his hand out to the sideboard and groped around as if searching for something. Kaoru noticed a stack of printed matter there, dozens of pages. He picked them up first and showed them to his father. "Is this what you're looking for?"
   The first page contained the following sequence of letters:
   10 20
   AATGCTACTACTATTAGTAGAATTGATGC
   30 40 50
   CACCTTTTCAGCTCGCGCCCCA…
   Kaoru recognized it at a glance: it was a chromosomal base sequence. "Saiki left those."
   "What chromosomes was he analyzing?" "This, of course," Hideyuki said, tapping his own chest. Now that the daily wash of tests was suggesting that the cancer had spread to his lungs, all he had to do to indicate the cancer virus was to point, with contempt, at his chest.
   This is the complete base sequence of the Metastatic Human Cancer Virus.
   Moved, Kaoru looked at the sequence of letters again. The dozens of pages he held in his hands contained the base sequences for nine genes; they held thousands, even tens of millions of letters; they held the blueprint for the virus that bedeviled them.
   9
   First off, Kaoru decided to visit the lab that maintained the massive memory banks of the Loop. The history of the imaginary universe known as the Loop was stored in 620 terabytes of holographic memory; even now, twenty years later, it was safe and sound.
   To get to the lab, it was faster to take the New Line than the old subway system. Kaoru left the university hospital and headed for the station.
   He only walked for a few minutes, but by the time he boarded, his T-shirt was wet with perspiration. It being early afternoon, there were few passengers. As a result, the air conditioning cooled the air a little too efficiently for Kaoru. In no time, his T-shirt felt clammy and cold against his skin.
   He had a seat and took from his briefcase the stack of printouts he'd just gotten from his father, containing the entire base sequence of the MHC virus. The sequence consisted of the letters A, T, G, and C, representing the different varieties of nucleotides. He could, he knew, stare at it forever and it still wouldn't get him anywhere in particular. But he had nothing to do. If he'd had a paperback he'd be idly flipping through it right about now, but as it happened his briefcase contained nothing else to pass the time with.
   A gene is essentially a unit of information, and the MHC virus had a mere nine of them. By way of comparison, a human being has something like 300,000 genes-so the virus's total was fairly small.
   Each gene can be represented by a sequence of a few thousand to a few hundred thousand bases; three bases form one amino acid. So, for example, a string of three thousand letters (ATGC… and so on) means that a thousand amino acids have all joined hands to create a protein.
   Kaoru scrutinized page after page, and when his eyes got tired he lifted his head and gazed out the window at the scenery. The print was so small that trying to focus on it through the jostling of the train was making him queasy. Above each row of letters was a series of numbers in multiples of ten, allowing the viewer to tell at a glance what number in the sequence each letter was.
   By scanning these numbers it was an easy matter to figure out how many bases constituted each of the nine genes. They ranged from a few thousand to hundreds of thousands. In order, they were:
   Gene #1: 3072 bases
   Gene #2: 393,216 bases
   Gene #3: 12,288 bases
   Gene #4: 786,432 bases
   Gene #5: 24,576 bases
   Gene #6: 49,152 bases
   Gene #7: 196,608 bases
   Gene #8: 6144 bases
   Gene #9: 98,304 bases
   Kaoru stood up and moved over to the door. The breeze
 from the air conditioner had been hitting him on the left side of his body. He especially disliked this kind of unnatural chill; if the cost of sitting was freezing, he'd just as soon stand.
   As he leaned against the door he idly pictured Reiko's face. But visions of his father's attenuated features kept coming to mind.
   The research centre where he was headed was a partial leftover of the place where his father had once worked. Kaoru knew that twenty-five years ago, upon finishing his doctorate, his father had been invited to join the Loop project, and that his father had devoted the next five years to researching artificial life. He didn't, however, know the specifics of what his father had been researching. It had all been before Kaoru was born.
   Every time he tried to ask, his father became close-mouthed. But the project hadn't ended well: that much Kaoru had been able to guess. Hideyuki was the type to jump up and down and celebrate when his work was successful, but he'd clamp his mouth shut tight in the wake of failure. Once Kaoru recognized the signs, he realized it wouldn't do to keep rooting around.
   But this time-maybe it was his age, or maybe his illness had softened him-when Kaoru had made to leave his father's sickroom with the sheaf of papers in his hand, Hideyuki had stopped him with a word.
   "Kiddo."
   Then his father, on his own initiative, had brought up the topic of his research some two decades before.
   "My area was to come up with a computer simulation of the emergence of life."
   His explanation was simple: for years it had been his dream to elucidate how life had first appeared on earth. But, as Kaoru had guessed, the experiment had come to an unforeseen conclusion, and it had been put on ice. His father didn't use the word "failed". As far as he was concerned, the experiment as an experiment could be considered a resounding success. But he still couldn't figure out why it had come out the way it had.
   "The Loop… well, you might say it turned cancerous."
   By which he meant that all the patterns in the program had been assimilated into one set pattern: all diversity vanished, and the program ground to a halt.