The first seed of appetite for training and driving my own self forwards was sown in that mild surge of enthusiasm for rowing. However, when I discovered freediving several years later I would commit every part of myself to this method, and to the idea that only through meticulous and sustained practice could I become all that I could be.
*
At university I was mostly taking papers in genetics, with a view to catching the cresting wave of technology in that field. The Human Genome Project was nearing its conclusion, and it looked like the next tech bubble was going to be written in the letters A, C, G and T (these denote four subunits in DNA, the order of which determines genetics). But towards the end of the degree course I started to lose interest. It was difficult to admit this to myself at the time, as there weren’t any other obvious careers offering themselves as replacements. Nonetheless, my subconscious was already rebelling against the prospect of being a scientist. In fact, it might have been rebelling against everything about my rational, conscious mind, as evidenced by these words, which seemed to appear on the page in front of me one day in my own handwriting:
Trapped with my thoughts in the court of my head, but the jury is dead and the plaintiff has fled.
There’s no escape from this mental self-rape; the disease of my reason is directed at treason and the only defences are senses, so stimulate them.
Stimulate them I did, with the requisite university program of pub crawls, tequila blow-outs and spotties on the stove (a way of smoking cannabis). Not to mention what we did on the weekends . . . As fun as it was, it was obviously not a fulfilling way to pass the time indefinitely. Without drink or drugs, that kind of blissful gratification can only be reached by an accomplishment that follows a certain amount of effort or anticipation. With these substances, I felt like I was reaching into my brain to press the pleasure button, bypassing the normal process of essay and attainment that it takes to experience those kinds of feelings. It felt like cheating. I wanted to experience the same sensation but with the fulfilment of knowing that I had taken the authentic route to get there.
It’s significant that we talk about a ‘calling’ when describing a strongly magnetic vocation. If you pay attention then you might actually hear it calling for you, in many subtle ways. I’d even say that it’s really a part of ourselves (one falling under the umbrella of the ‘subconscious’) that is more in tune with our true desires, or dharma, that is doing the calling. So it was when the words for a short poem formed in my mind on the dance floor of an Auckland night-club. A friend had talked me into going out as an alternative to going to bed, so I was sober, which made it an eerie and alien experience. I was too alert, too self-conscious. In more recent times I’ve felt that same sensation — being almost too present — in the minutes leading up to a record attempt or competition dive. That night, the only way I could escape the feeling was by fixating on the music and on a video being projected on one of the walls of the night-club. It showed graphics like a screensaver, which seemed to zoom into a morphing image without any point of arrival. I was able to shake off my hyper-alertness while I plunged into the music and those flickering images, and from that empty-minded state these words arose:
I have a relationship with the depths
They beckon me beyond my means
Cold, dark, vacant pressure
Forever night, muted dreams.
Even to me it seems that this could only have been written by a freediver, or at least someone with fervent dreams of becoming one. But at the time I had no such dreams. If you’d asked me, I might even have confused a freediver with someone who somersaults from cliffs into the water. Nonetheless, I felt those words and the gleam of significance they arrived with. I repeated them to myself while I danced, until they were firmly memorised and I could write them down when I got home.
But what kind of relationship with the depths did I have in those days? I lived in a flat renowned for its student parties, above a busy Newmarket street; I studied retroviruses and vector fields by day, drank beer and chased indifferent party girls by night. The only time I held my breath was after inhaling balloons filled with nitrous oxide (laughing gas) from whipped-cream chargers. Most of the time I wasn’t consciously aware of anything lacking in my life, so it alarmed me a good deal when a perceptive friend suddenly stopped short in mid-conversation to exclaim, ‘William, you’re turning into a munter!’ The indignation I felt at her words only demonstrated their nascent truth.
No, there was no relationship with the depths being had. Not in those years.
I did have high aspirations for myself, and felt, viscerally, as if I could only be satisfied by a truly singular accomplishment — but would never have admitted it, or had any idea what kind of accomplishment it might be. I was besotted with Alana, a girl in her senior year at university, who didn’t need a dead-end romance with a confused man-boy but was kind enough to tell me, ‘You’ll go on to great things, I know it.’ In the summer of 2000, when she visited me with friends at my parents’ house, I tried to impress her by swimming, underwater, two laps of the 25-yard pool (equivalent to 47 metres DNF — ‘Dynamic No Fins’) at the private school where my mother taught. Before this, I hadn’t swum more than about 30 metres underwater and still didn’t know a thing about freediving, or even that such a sport existed. Turning after the first lap I felt the primal scream for air, made all the more intolerable by the fact that air was there, so tantalisingly close, above my head. I remember thinking that completing the second lap was the hardest thing I’d done in my life. Afterwards, when Alana asked me — with flat indifference — ‘Was it worth it?’, I didn’t know what to say. Now I know that, yes, it was worth it.
All of the breadcrumbs that brought me closer to the gingerbread house that is freediving were worth it. For instance, there were the times when my brother and I would hold our breath while the family car was being driven over bridges. This was normally a matter of seconds, although the Auckland Harbour Bridge was a challenge that at first appeared insurmountable but was nonetheless met at some point, just as depths in my career have passed from the distant horizon of possibility into the rear-view mirror of the accomplished. Then there was the New Year’s Eve (2001) rock concert by the shore in Napier. Friends I had gone to the party with had all hooked up with girls, and I wasn’t relating to the crowd around me. On a whim, just before midnight, I walked outside the venue and down to the beach, stripped to my boxers and jumped in the sea. As the distant crowd chanted out the countdown, I took a breath and ducked underwater for the final seconds, re-emerging in a new year. I didn’t become a freediver that year, or the next, but in hindsight it seems as if that night was a window to my future.
It took a year working as a scientist before I finally pulled the pin on that career path. The year was spent at Genesis, a genetics laboratory in Parnell, Auckland. Most of the work involved sequencing (reading the genetic code) of samples from New Zealand’s agriculture and horticulture industries. I started in a small team of five that ran the sequencing machines, and progressed to leading the team by the end of the year. As much as it was a stable job and lifestyle, I felt I was betraying the caller and the dreamer in myself. I shifted liquids from one 96-well plate to another, added, removed, centrifuged and ran electrophoresis gels, and at the end of it the computer listed a stream of letters like AAAAGTGCAACAATGGTACTTGGGACTAGCCTAGCATAT, which was recorded in a file somewhere. But what did I have to show for my time other than the pay cheque I received every two weeks? Of course, I was on the bottom rung of the science ladder, the idea being that with time I could climb to a point where I would engage more of my mind and creativity in genetic research. The next rung that was being offered was a place in an Arabidopsis (rock cress) phenotyping project. But I’d lost any vestige of patience, and so in the summer of 2002 I planned my escape: the OE (overseas experience) to Europe, with no fixed date of return.
*
I started by travelling to Samoa, one of the few Pacific island groups
that we hadn’t visited on Hornpipe, and a convenient stop-over on the way to America. At Auckland airport, my close friend Dwayne Cameron came to see me off and handed me a pellet of cannabis wrapped in tissue paper. Although I swallowed it right there before going through security, the tissue must have insulated its contents for a while, as the weed didn’t kick in until the wee hours of the morning when I had already landed on the main island of Upolu. I drifted through the sleeping capital of Apia and sat on a beach listening to the portable CD player I had bought for the trip, waiting for sunrise when a tiny plane would take me across to the more rural island of Savai’i.
Once landed, a colourful, jouncing bus took me around the north coast road to where I would stay for a week in a collection of fales (huts) that adjoined the beach. At night, the gentle noises of wavelets folding onto the sandy beach stirred up memories from my childhood. It felt right to be there. I didn’t do anything during the day other than snorkel in the lagoon or hike up through the jungle to try to get a view of the island, but I was deeply satisfied and at home in a way that I could never be in a city or laboratory.
I spent the second week on the main island, living in Apia and being adopted by a group of fa’afafine, Samoa’s third-gender people who embody both masculine and feminine gender traits, and have formed an integral part of the Samoan culture since at least the early twentieth century. They were the most fun-loving people I had ever met, and showed me the best beaches, swimming holes and bars on Upolu. One of the group, Candida, mentioned an underwater swim-through that connected two sea caves, and immediately I became fixated, bombarding her with questions: How deep was it? How far across? Was it dark? She eventually agreed to take me there, but it was obvious that she was concerned about my safety. The two parallel caves cut back in from the shore into the rock, and we were able to wade into the southern cave to the point where the swim-through started. Ducking under, I could see the glow of green light, and without thinking I started to swim towards it. After the second stroke my head collided with a bulge in the ceiling, eliciting a moment of panic; but it was okay, I was already nearly through. The distance was probably less than 10 metres and not very demanding at all, but it was still rewarding to pop up in a completely different cave among a group of confused swimmers. A minute later, Candida arrived in a frantic commotion — terrified of swimming through herself, she had run around to the other cave entrance to find out what had become of me.
*
From Samoa I flew to Los Angeles to rendezvous with Michael, who had completed a season of snowboarding in Jackson Hole, Wyoming. We drove to Tijuana in Mexico, arriving at 3 a.m., slept in the car and were woken and extorted by a policeman, took a look around town and decided to drive to Las Vegas, where we were extorted instead by street hustlers, croupiers and plastic-tasting breakfast buffets, before driving back to Los Angeles with our tails between our legs. I think my dislike for big cities might have been born around this time. Michael flew home to New Zealand, while I practised diving into the pool off the second-floor roof at Backpackers Paradise in Inglewood. I asked another backpacker to take my picture from the water as I dived over him, and took a slightly bigger run-up. I easily cleared him — and the deep end of the pool: soon after I hit the water my face encountered the concrete gradient where the bottom of the pool sloped up towards the shallow end. The tip of my nose was pressed flat against my right cheek, the sensation accompanied by the cracking of gristle. This break has meant that my left nostril doesn’t ventilate as well as the right, making it more prone to infection from airway viruses. Now most head-colds and ear infections begin on the left side of my head, and my left sinuses are more prone to lingering inflammation. Since all these conditions make it impossible to equalise pressure in my middle ears or sinuses, and hence to freedive, that one foolish high-dive has probably been responsible for weeks or months of lost training and competition dives over the course of my career. The accident brought a conclusive end to any kind of aerial stunts for me. From then on I had more respect for gravity, and all my diving would be underwater.
After a road trip to Vancouver and Calgary I flew to London, a kind of default city for vagabond Kiwis in need of travel cash. It would be my base for the next nine months, during which time I worked as a porter/valet in a small Kensington boutique hotel, Blakes, that was frequented by celebrities wanting to maintain a low profile. There I earned more in tips than my wage as a scientist in New Zealand, and I started thinking about where I could travel to next. London, in fact megalopolises in general, were not for me — that much was clear. At 3 a.m. one Saturday night I found myself at a North London house party, surrounded by a heaving mass of shirtless ghouls, pupils dilated and teeth grinding in time to some soulless music. I looked around and realised that I was as much a member of this crowd as any. ‘I have to get out of here,’ I told Michael — the only person I knew at the party. He seemed relieved at the suggestion.
Michael had arrived in London fresh with stories of a month in Thailand, where he had studied to be a scuba-dive master. In the same centre there had been some people practising ‘freediving’, and when he talked about them, and about the current champions such as the Italian Umberto Pelizzari, my attention was captivated in the same way it had been when Candida mentioned the underwater cave swim-through in Samoa. This was the intersection in my life when the world of freediving — a world that had been bustling along without my knowing it, a world with its own history, protagonists, rivalries, records, tragedies, cultures and myths — made its presence known to me. In the following days and weeks, I read interviews with the top freedivers, looked up definitions for pranayama and other techniques they employed, held my breath on my bed (my first attempt was a pretty ordinary 2:15 — 2 minutes 15 seconds) and dreamt, wondered . . . what would it be like?
CHAPTER 3
RETURN
Chasing light beams down into the abyss
He is at one with every swarm of lime-green fish, with every coloured sponge. As he holds himself to the ocean’s faery floor, one hand clasped to a bedded whale’s rib, he is complete and infinite. Pulse, power and universe sway in his body. He is in love.
Mervyn Peake, Titus Groan
THE DOOR TO WHAT HAD JUST BECOME my ex-flat in Wimbledon, London, closed behind me. I carefully unfolded a square of tissue paper and took its contents between thumb and forefinger: a pill that looked like a biscuit crumb—small, misshapen and earth-coloured. My mother had given it to me the year before, one of three she had received from an emissary of the Dalai Lama. They were known as ‘compassion pills’, and had been created and blessed by Tenzin Gyatso, the fourteenth in the line of Dalai Lamas (dalai is a Mongolic word for ‘ocean’ or ‘big’, while lama is Tibetan for ‘guru’). I’d been saving this compassion pill for the right moment, which was now. The January air was clear and crisp with frost. As the crumb dissolved beneath my tongue, I shouldered my backpack and set out for the train station.
It was 2003, the year I returned to the sea — and found freediving. When you lie on the surface of the ocean and gaze into its depths, you have no idea of what is contained in that void below. Likewise, I had no idea where this voyage back to the Caribbean would take me. I had a flight booked to Belize, with the vague intention of following the coast of the Caribbean Sea down the Central American isthmus. En route I spent two nights in Miami, where I bought wetsuit, mask, fins and a flimsy pole spear; my evenings were occupied with drinking and courting South Beach girls (even the Dalai Lama’s magic can’t cure all vices!).
In Belize, an airport bus took me and some scuba-diving tourists to the port, from where a motorised skiff ferried us to the nearby islands scattered among the offshore barrier reef. The long, narrow powerboat swept in broad turns between low, mangrove-covered cays as I listened in my headphones to Tracey Carmen’s chanted cover of ‘Song to the Siren’.
*
Like most Caribbean islands, Caye Caulker had a pretty side, where the bars and backpackers’ spilled ont
o the beach, and a more run-down backside of mangroves and shanty homes. I had a bed in the cheapest backpackers’, where the beleaguered matron raved and ranted at her guests for their messy habits. She would inevitably win each battle, but I suspected that with a complete refresh of guests every few days she was never going to win the war.
I wasn’t there for the customer service or the beaches, however, and quickly found a scuba-dive company that didn’t mind me tagging along on their trips. On the first day we were taken to a site in 15 to 20 metres of water. The guide led his retinue of tourists down to the bottom, columns of bubbles ascending from each cluster of hoses and aluminium tanks. I watched from the surface, breathing through my snorkel, wondering whether I could reach the same depth. To my surprise, on my first attempt I swam all the way to just off the bottom, and spent several seconds there gazing around. I was floating above a landscape of undulating coral ridges, separated by strips of sand that filled the valleys between them. Fish flickered, bounced and soared in the midwater, swarmed and spun above distinct coral outcroppings, or slunk through coral hedges and shady gullies. Surface waves split the sun into flickering beams that tattooed erratic patterns of light over the whole scene.
I absorbed the sight, and for a moment my mind was a silent observer. Three years previously, living in that urban student flat in Auckland and with no physical escape other than lifting grimy weights in a basement gym, I had felt like I was ‘trapped with my thoughts in the court of my head’. Now, as I held my breath and absorbed the underwater vista, I had broken free, for the briefest moment, from that unsolicited podcast, that relentless stream of internal dialogue. I was my naked self behind my mind.
Oxygen Page 4