by Zen, Raeden
“Go on, dear,” Genevieve said.
The slip of the tongue, mentioning Damy, dead Damosel, brought a knot the size of a cannon into Gwen’s throat. Memories of the Bicentennial flooded forward. “I … I … was the champion,” Gwen said. “That feels like another lifetime for me now.”
“We’ve had a few Harpoon Champions from Boreas in recent years, and more still in the future if I have my way.”
The women ambled along a pedestrian path, and Genevieve greeted well-wishers. Lime-green transports whizzed along the nearby depressed maglev track. Gwen had seen renditions of Boreas City but never experienced it so close. Ice sculptures of ringed planets and busts of Chancellor Masimovian dotted the walkway. Carved-ice pyramids led to residential units below. Skyscrapers towered above, and snowy mountains ranged over the horizon, fixed in space and time.
She wanted to stay here forever.
They rounded a corner and moved partway down a hill. Ahead, a trellis of flat gray slabs crisscrossed by maroon beams opened down into the earth, onto rows upon rows of maroon marble benches, enough seating to fit all fifteen million residents from Beimeni City.
“We’ve reached the part where you will request the use of Faraway Hall to showcase Antosha’s candidacy for Reassortment,” Genevieve said.
Gwen trembled.
“Dear child, he could never deceive me, then or now. He’s not the premier skilled telepath in the commonwealth anymore.” Gwen felt her face flush. Genevieve teased the feathers at the cuffs of her sleeves. “I’ve been a minister for far too long, and while we had steady scientific leadership in Ventureño during Barão’s tenure, I fear we’re about to prove the theory of entropy and return to the days of old, when the leadership of our ardent task changed as swiftly as the winds.”
“Minister, I must apologize for my ignorance.” Two mistakes now, Gwen thought, a third, and I may not recover. “I understand the campaigns of old have been long forgotten and that Antosha’s request may appear in that tradition. In this, I must admit, I’m not as well versed or as wise as you.”
If she obtained use of the hall, Gwen knew, she’d also obtain Genevieve’s vote of confidence for Antosha’s Reassortment candidacy. “One comes with the other,” Antosha had assured her. And with it could come more votes in the North, the region where, according to Antosha, the ministers under Genevieve’s leadership had tried to negotiate independence from Phanes, long ago. Almost no one in the commonwealth knew about these secret talks, and indeed, Gwen didn’t know how Antosha had learned about them or why the talks even occurred, until now.
Gwen handed Genevieve a z-disk. “We near the end of the Regenesis research, and we’d desire nothing more than for Boreas, your majestic territory, to be the host to reawaken Dr. Kole Shrader.”
Genevieve patted her chest. “Oh, I didn’t realize …” She seemed out of breath. “We do have all the tools he would need here in Boreas …”
Gwen felt as if her heart would fly away. She didn’t move, didn’t shift her emotionless expression. Genevieve peered down the thousands of rows of seats, and Gwen hoped she was imagining the evening, grandiosity at a level that no minister could refuse.
“So it will be,” Genevieve said. “My territory can use the benari infusion.”
ZPF Impulse Wave: Oriana Barão
Halcyon Village
Dunamis, Underground West
2,500 meters deep
“You’re forcing it,” Pasha said. “That’s why you can’t connect to the ZPF. That’s why you can’t feel the panel’s connection to the quantum universe.”
Oriana stared at the glossy panel in Pasha’s room. In her mind’s eye, she saw Alpinia City as clearly as she saw her twin brother, the white marble buildings, sinuous streams, pillars, and statues.
But the Granville didn’t hear her.
It didn’t answer her message.
How does he do it? Oriana thought.
Pasha could send his consciousness into the ZPF and into Granville panels and create whatever part of the commonwealth he desired. Yesterday, he’d shifted their suite in House Summerset from the Great Falls of Navita to the Great Gorges of Gubertiana to the Great Spas of Natura to Urelayura Hall in Alpinia City, where the Trimester Trek would be held. The Trek had been all the candidates could talk about after yesterday’s class when Lady Isabelle informed them of the rules. “You will choose teams of five,” she had said. “You will arrive in Urelayura Hall no later than twelve hundred hours. Failure to check in will result in disqualification. Disqualification will result in a reduction in your starting point for the first half of the Harpoons. A reduction in your starting point will lower your probability of being selected as team captain for the second part of the exams.”
Oriana believed that in order to win the Harpoons, she’d need to be named a team captain.
She tried again to connect to the ZPF but couldn’t get through. She screamed and punched the panel.
“What’s going on in here?” Lady Parthenia said.
Oriana looked down. Her knuckles were bleeding. Skin and blood splotched the Granville panel.
“Who’s going to want me on their team for the Trimester Trek?” Oriana yelled. She held her hand against her burgundy silk nightgown and pushed past the lady, back into her room and bathroom, where she washed off her knuckles. I’m a champion, she thought as she cried. I’m a champion, I’m Champion of the Harpoons. Yet how could she win if she couldn’t even alter a Granville panel? How was it that Pasha advanced with his use of the ZPF so much quicker than she?
He’ll get a good team for the Trek, and I’ll be left behind, she thought. Why? Why? WHY!
“Oriana, may I enter?” Lady Parthenia said without her typical roughness.
“Leave me alone.”
“Oriana, it isn’t your fault. We’ll work on this, I swear, you’ll get it, we all do.”
“What if I don’t?”
“You will.”
The lady let herself in. Oriana sat against the wall upon the cool marble floor. Parthenia slid down to meet her. She put her hand on Oriana’s knee. Oriana shook away from her and looked toward her crystalline shower. She sniffled.
“It took me a little bit longer, too—” Lady Parthenia continued.
Oriana turned. The lady pursed her lips, her eyes blinking away tears. It was as if she did understand what Oriana was going through. She patted Oriana’s knee.
“Falcon Torres entered a Granville world on the first day of classes,” Oriana said. “Other candidates can alter Granville syntech like Pasha does. But I can’t! How can I receive the first bid if I don’t understand the ZPF—”
“Oriana, if you don’t believe in yourself, no one else will.”
Oriana nodded and wiped the tears from beneath her eyes. She looked up, reaching with her mind for the Granville sphere that dangled from the ceiling. She sighed. “Why can’t I feel the zeropoint field?”
“To feel the field, keep your mind steady,” Parthenia said. “To connect to the field, perceive the subatomic world the same way you would the world around you.” Parthenia stood and extended her hand. Oriana grabbed it, and Parthenia lifted her. “Don’t let your mind distract your body, and don’t let your body distract your mind.”
Oriana looked down. Parthenia lifted her chin. “Look, here,” she said. She held her palm in front of Oriana. “Put your hand on mine.” Oriana did so. She felt the lady’s warmth.
“Keep your hand steady.” Parthenia pulled hers away from Oriana’s.
Oriana felt vibrations upon her fingers and palms, the sensation not unlike clapping her hands quickly.
“There’s a rhythm to the ZPF,” Parthenia said. “The universe is filled with its energy.” She looked up to the Granville sphere. So did Oriana. “The ZPF is the basic substructure that contains all the possible varieties of matter.”
The lady activated the sphere. A desert landscape beneath a starry sky formed around them. It felt as if a dry, cool wind touched Oriana’s skin, b
ut she knew that was just the Granville syntech influencing her senses.
“Its information is encoded and transmitted all around you,” Parthenia continued, “all at the same time.”
Oriana frowned, then smiled, for while she couldn’t alter the Granville world, she could sense the universe’s substructure. “Why didn’t you teach me about the ZPF before the first class?” Oriana raised her voice. “Why didn’t you prepare me to enter a Granville world?”
“You weren’t ready yet.” Parthenia deactivated the Granville sphere, and Oriana’s bathroom, its smells of geraniums and lilacs, its crystalline shower, its marble floor, returned to Oriana’s sight. “You must learn to control your mind’s energy before you learn to control the energy of the universe,” Parthenia added.
“Why can’t you just show me how to do it?” Oriana folded her arms, looking toward the doorway. “Why do Pasha and other candidates manipulate the field in ways I cannot—”
Parthenia snorted. “Care not what others around you do or do not do,” and when Oriana slouched, “anyone who thinks they can understand the zeropoint field after a few days of development is deluding themselves.”
“What do you mean?” Oriana straightened. “They’re faking it?”
Parthenia grinned. “No, that’s not what I meant.” She held Oriana’s head with her hands and looked into her eyes. “It’s sometimes easier to see what’s large rather than what’s important. My face, for instance, do you see it?”
“How could I not?”
“Look, closer.”
Oriana pursed her lips and blinked.
“Closer,” Parthenia repeated. “That’s it, keep at it, there, there, do you observe the particles that make up my being, in the ZPF?”
Oriana narrowed her eyes. She sensed the ZPF around the lady, penetrating her as it did the air, the walls, all matter around her, but she didn’t see any particles.
“Don’t see,” Parthenia said as if she knew Oriana’s thoughts. “A weak eye sees, a strong one observes. Learn to observe the world as it exists in the ZPF and no one will defeat you.”
Harpoon VR
Northwest
0 meters deep
Oriana’s breath puffed from her mouth in quick bursts, her head was layered with wool, her neck surrounded by fur, the pack on her back as heavy as a boulder. She ran toward an icy pole that glowed with orange light. On it, a golden flag shivered in the wind. The flag contained a telepathic message, which Oriana accessed in her extended consciousness.
PROVIDE THE SUM OF ALL INTEGERS FROM 1 TO 1,000,000, INCLUSIVE
She began the computations, but the wind and the snow twisted around her, and with it, a sound.
Owoooo. Owoooo. Owooooooo.
Oriana lurched around and scanned the blizzard landscape. Snow-covered trees swayed near, the shadows of snow-covered mountains loomed afar.
It’s the gusts, she told herself.
She returned to her calculations.
Owoooo. Owoooo. Owooooooo.
Nope, she thought, definitely western wolves.
The calls of the wolves carried from mountain to mountain and surrounded her.
It had to be Pasha’s influence, but how?
Their cries made her shiver in a way the wind could not. But every second she stayed distracted, she lost invaluable time in her search for the solution, and she knew that timely solutions led to higher point totals during a Harpoon simulation. The more points, the higher she’d rise on the Harpoon leaderboard—a measure of success prior to the Harpoon Exams.
The sweat was building up beneath her bodysuit. Concentrate, she thought, this can’t be anything compared to the Harpoons. She pushed the wolves and the wind and the silent snow away from her consciousness and focused on the task. At last, she discovered the solution and communicated it, 27,000,001, to the fluttering flag.
The flag released into Oriana’s hand, and she shifted it to a satchel at her side. She dashed toward the next wooden bridge—half a kilometer in length, laced with snow. Waterfalls crashed below her. She ran by the light of a blue moon as large as the jagged gray mountains on the horizon. She caught a whiff of Pasha’s wolves with her enhanced sense of smell, which slowed her, but she dashed to the end of the bridge and solved the next problem. She lifted the marker. A few more to go, then she’d defeat Pasha—for the first time!
She continued on into a frozen forest. Under cover of brush, leaves, and snow, she eased against a frozen tree and caught her breath. She lifted the bottom of her mask and sifted through her satchel, clutched a canteen, and chugged.
Lady Parthenia’s voice reached her mind.
Don’t drink too much, young lady, you’ll get a cramp and then what good would that water do?
Oriana took another swig. Why should she listen to the lady, who hadn’t prepared her for the first day of classes, who still hadn’t taught her how to manipulate the Granville panels or communicate mind-to-mind the way she just did?
Oriana tired of the lady’s constant lectures and cryptic messages. Parthenia forced her to read sentences forward and backward and master molecular chemistry and calculate thermodynamic free energy and untie knots and manipulate complex origami and construct palindromic words, sentences, and paragraphs, none of which helped her improve her connection to the ZPF!
Go on, she thought, keep yelling and I’ll keep drinking!
She sucked down the rest of the water, then returned the canteen to her satchel and sprinted for the maze.
The air whistled over her and brought with it the dank stench of wolf. Oriana grimaced. The roars resumed, but she suspected this altered cry must be designed to help Pasha determine her location. Where was he? She timed the next set of howls, extended her consciousness, and used an algorithm to estimate Pasha’s location.
Close, too close.
She darted across a labyrinth of snowy trees, hopping from limb to limb, and jumped to the hard, snowy ground, rolled, then jogged down a hill toward a bridge that she calculated in her extended consciousness extended for thirty kilometers. It glowed dark blue, surrounded by a spiral of alloy coils about twenty centimeters thick. Oriana sprinted over the bridge but lost her balance and spun out. She smashed into one of the coils and rolled along the ice. Can’t fall! Can’t lose!
Her parka burst at her elbow, and blood streaked down her arm. She pulled a shot of uficilin from her satchel and injected herself. The cut began to heal. She wrapped her elbow to avoid exposure. Now Oriana took methodical steps, gripped each coil and eased along the windy bridge: one step, hold, two step, hold, three step, hold. When she cleared the coils, she carefully slid down a cliff. The snowfall stopped. Ahead of her, a chunk of ice that forked into the sea was melting, and its water crashed and curdled and steamed.
Renewed howls shook Oriana’s concentration until she noticed that the ice on the mountain above was melting too. And rolling toward her in an avalanche! She drew two diamond daggers and used them to climb the ice back up to the bridge. She turned. The avalanche crashed into the ravine and the sea. Oriana made her way to the other side of the glacier, where the golden marker hung twisting in the gusts. She activated the message.
IDENTIFY THE UNIQUE SEQUENCE IN THE FOLLOWING GENOME AND INDICATE HOW MANY TIMES IT REPEATS
Oriana grunted. While she devoured novels, Lady Parthenia made her read thousands of pages of random prose, locate the unique phrase that repeated, then count how many times it repeated.
Now she’d moved on to DNA. This particular genome was relatively small at 375,000 base pairs. The letters scrolled through Oriana’s extended consciousness.
CACGTTTCACGTACCGTTACAT
CGTTATCGTTCACGTACTGGTG
AACCCACGTCGTATGTAAGGTT
TCTCGCACGCACGTTTCCTGCG
CACGTATTACGGTATCCGGTTC
ATCTTCTGCACGTTTGTCACAC
CGTCGTCCGTACGGTTCACGTA
Similar to prior exercises with words, phrases, and sentences, Oriana found the unique letters with ease, the repeated sequence being C
ACGT.
CACGTTTCACGTACCGTTACAT
CGTTATCGTTCACGTACTGGTG
AACCCACGTCGTATGTAAGGTT
TCTCGCACGCACGTTTCCTGCG
CACGTATTACGGTATCCGGTTC
ATCTTCTGCACGTTTGTCACAC
CGTCGTCCGTACGGTTCACGTA
Oriana scrolled through the genome and calculated the sequence CACGT appeared 15,547 times. She sent the solution, retrieved the flag, and rushed into the woodlands. She slowed before a mass of thick tree branches wrapped in ice, connected by ice, dead under the ice.
She calculated more than thirty routes in thirty seconds in her extended consciousness. A new riddle. One path would bring her to the next marker. Only one would keep her ahead of Pasha and lead to victory. She determined the direct route based upon a technical readout of the terrain. Neon lines and geometric shapes moved in various directions in her extended consciousness. The smell of singed leaves tickled her nose. The stench from the wolves made her cough. Silver lines crisscrossed and zigzagged as Oriana created the necessary algorithm to determine which way would require passage over the fewest, strongest icy branches.
And she flew.
The spikes on her boots kicked up the ice and left powder in her wake. She weaved through the branches, over the ice, slid to the penultimate marker, and scooped it into her satchel. She sprinted onward until she arrived at an electric-blue fence. A golden marker hung there, but she couldn’t pry it free, and it offered no challenge. She gazed beyond the fence, beyond the platforms. Water flowed over stone, around stone, and beneath stone, defying the law of gravity in this simulated world. Pasha stood beyond another fence, far away on the other side. Between them, Oriana counted sixty-four square platforms, lined up eight-by-eight in a diamond-shaped formation, capped with a mixture of ice and stone.