The genes of N.P.V. can be changed easily without causing harm to the virus. Many viruses are difficult to change. They are too sensitive. If you change their
Cross section through a crystal of Autographa californica nuclear polyhedrosis virus. Magnification 25,000 (Electron micrograph courtesy of Dr Malcolm J. Fraser, Jr, and William Archer, Department of Biological Sciences, University of Notre Dame.)
genes, they stop working. But N.P.V. is a rugged, tough, flexible virus. It can be given foreign genes that change its behavior as an infectious agent. Hopkins knew enough about viruses to know this, and it chilled his blood to make the identification. He knew that buried somewhere in the code of the Cobra virus he would find engineered genes. Genes that had been put there,
enabling the virus to replicate in human tissue, specifically in the central nervous system.
Cobra was a recombinant virus, or a chimera. In Greek mythology, the chimera was a monster .with a lion's head, a goat's body, and a dragon's tail. 'The chimera,' Hopkins whispered, 'was a tough monster to kill.'
He put a few more drops of sample liquid into Felix and started Felix on another run, pulling up more DNA code. Austen had finished her autopsies, and for the moment she did not have work to do. She suited up and went back into the Core to see what was going on there. Suzanne Tanaka went back to work with her microscope.
Signatures
In the Core, James Lesdiu was running a forensic analysis of the physical materials used in constructing the two boxes. They were bombs. All bombs, as Hopkins had so passionately maintained at the SIOC meeting, contain forensic signatures that can guide an investigator to the builder of the bomb.
Austen found Lesdiu sitting at a table in the center of the materials room, the cobra boxes before him under bright lights. He was holding an old-fashioned magnifying glass in one hand and a pair of tweezers in the other. His hands were enormous. They were covered with double rubber gloves.
'I'm dying inside this suit,' he confessed to Austen. He was dressed in an extra-large F.B.I. biohazard suit, and he looked extremely uncomfortable. His Racal hood was beaded with sweat on the inside. He had draped a towel over his shoulder - inside his hood. Now he shifted his shoulder, turned his head, and wiped the sweat off his face using the towel.
Lesdiu probed the tweezers here and there in one of the boxes.
'I'm looking for hair-and-fiber evidence,' he explained. Lesdiu plucked at something inside the box. 'There's another hair. It's another Q.'
Austen had never heard the term Q.
Lesdiu explained that he had found some unknown human hairs. 'They're questioned hairs,' he said. 'We call unknown samples Q evidence, or questioned evidence. It's questioned because you don't know what it is or where it comes from.' He had placed the hairs on a sheet of brown paper. 'Samples are either questioned samples or known samples. The questioned samples are things that are found at the crime scene. Sherlock Holmes called them clues.' He smiled. 'Os are physical evidence. We analyze the 0 samples, hoping to match them with something known. Forensic science is largely pattern recognition. The Os are things like fingerprints, hair and fibers, blood, toolmarks, shoe prints, all kinds of trace evidence. DNA is trace evidence. The DNA of the Cobra virus that you've been looking at on the screens, that's a questioned sample, because we don't know where the Cobra virus comes from.'
Austen realized that this was very similar to what she had been doing in the beginning, when she had traced the outbreak to the boxes. 'You guys are doing a diagnosis of a crime.'
'In a way, yeah,' Lesdiu said.
The F.B.I. maintains enormous reference collections of known samples of all kinds of objects. These are called reference knowns. 'If you can match a fingerprint, you can get a conviction,' Lesdiu said. 'Because a fingerprint pattern is unique. But forensic evidence is not always so clear. That's why you usually need a lot of it.'
Lesdiu put his tweezers down. He was taking a break. 'I've got two hairs so far,' he said. They come from the Zecker-Moran box. One is a fine, reddish hair, with an oval shaft, Caucasian.'
'That sounds like Kate's hair,' Austen said.
'It probably is,' Lesdiu said. 'Frank Masaccio's folks are getting some known hair samples from her bedroom. As soon as they arrive, I can start comparing Qs and Ks. The
other hair is oval and transparent. It's a gray hair from a Caucasian.'
'Penny Zecker' Austen said.
'Maybe. We'll be getting hair samples from her house too. I also found some wool fibers. Black. Maybe from a sweater - maybe the girl's sweater, maybe not. The other box, the one the homeless guy carried around with him -' Lesdiu indicated the Harmonica Man box, which was sitting beside the Zecker-Moran box. 'This one has a ton of fibers all over it and in the cracks. The fibers are cotton and polyester. The box was wrapped up in the guy's clothes. I have to say that anyone who was smart enough to load this box with a virus is smart enough not to leave any hair or fibers on it. This fiber analysis is not going to pan out. My bones are telling me that. But there's more than one way to skin a cat. There's a ton of microscopic evidence in these boxes.'
Jimmy Lesdiu had set up a row of machines in the materials room. One of them could throw a beam of infrared laser light on an object and then analyze the spectrum of the light bouncing off the object. The machine gave information about what the sample was made of. It could also see invisible fingerprints on a surface. Lesdiu had also set up a machine that could vaporize a sample and identify the atoms in the gas coming out of the sample.
Lesdiu found a number of fingerprints on the boxes. He photographed them in laser light and sent the images by satellite to Washington, where the fingerprints would be analyzed. Later, it would turn out that none of the fingerprints belonged to the Unsub. They belonged to Kate Moran and Penny Zecker. The Unsub had been much too careful to leave fingerprints.
A shiny black enamel had been used to paint the design on the box. With the infrared laser, Lesdiu got a
spectrum of colors from the paint. To the human eye, the paint was black, but to the laser it was a rainbow of colors. Lesdiu passed the paint spectrum on to Washington, and within minutes an F.B.I. expert in paint called him back on the telephone. The call came into the hot Core on a speakerphone, since you can't use a telephone handset if you are wearing a Racal hood.
'You folks in Forensics must be standing around waiting for me to call,' Lesdiu shouted on the speakerphone to his paint expert.
'We've been told to respond quickly. Frank Masaccio will kill us if we don't.' The paint expert went on to say that the paint was a common enamel model paint. It was sold in hobby shops everywhere.
The signature had petered out into a maze of common objects. This was typical of signatures. Still, the paint was a Q that could be tied to a K, if a suspect turned up with enamel model paint.
The cobra boxes had bits of paper glued to them, on which words were written - Archimedes' name and the date. The bits of paper were glued to the box with a clear, flexible glue. With a razor blade, Lesdiu cut away a tiny shred of the glue. 'It's kind of a rubbery glue,' he said. 'I'd say it's a silicone glue or a hot-melt type of glue.'
He dropped a bit of the glue from the knife onto a glass slide, ran it through the laser machine, and got some data. 'I got a real nice infrared spectrum of this glue. Look at that, isn't that beautiful?' he said.
Alice Austen stared at the screen. It was a meaningless jagged line to her. She told Jimmy Lesdiu as much. 'There's information in these peaks and valleys,' he said.
'If you looked at a cell, you wouldn't see much in it,' she said to him. 'I would see a world.'
There was a man at F.B.I. headquarters who could see a world in a drop of glue. They called him the Maven of
Glue. James Lesdiu sent the spectrum of the glue over an encrypted satellite link to the F.B.I. forensic lab at headquarters in Washington, meanwhile talking on his speakerphone to the scientist known as the Maven of Glue. The Maven put Lesdiu on hold for a few
minutes, and then said to him, 'Okay, Jimmy, I've checked the spectrum against our library of adhesives. You are not going to be happy, Jimmy.'
'I'm listening,' Lesdiu said, standing by the speakerphone.
'The spectrum you sent is consistent with a silicone glue made by the Forkin Chemical Company in Torrance, California. It's called Dabber Glue. They sell millions of tubes of this stuff. You can buy it in any hardware store. I really like it. It's a nifty glue. I use it myself at home.'
Austen said, 'Why doesn't somebody call Forkin Chemical?'
Lesdiu shrugged. 'That would probably be useless. They can't trace millions of tubes.' Nevertheless, he called Frank Masaccio with the information, and an F.B.I. agent got in touch with the president of Forkin Chemical. The agent and the company president had a very pleasant conversation, and the president called an emergency meeting of his technical people and his top sales staff for the northeastern United States. But in the end, there was nothing the management of the company could do to help narrow down the retail source of the glue. The company said that there were at least three hundred retail-outlet stores in the New York area that would be selling Dabber Glue. And of course the Unsub might not have bought the glue in the northeastern United States. The glue was sold everywhere.
Lesdiu held the box in his long fingers, squinting at it. He looked at it with his Sherlock Holmes handmagnifying lens. He found some kind of black, powdery
dirt embedded in the glue. Very fine particles of dirt, jet black.
'I'm going to nail this dirt,' Jimmy Lesdiu said.
He had to separate a few particles of dirt from the glue, and silicone does not dissolve in most solvents. But after a further conversation with the Maven of Glue and with chemists at headquarters, Lesdiu came up with a solvent that would work. He rooted in one of the supply boxes, shuffling through bottles, until he found what he was looking for. Then he dissolved a bit of the glue in a small test tube, and swirled the particles. A blackish, brownish haze hung in the liquid. Now he had to separate the particles. He returned to a supply box and found a magnet. He held the magnet against the test tube. The black dust drifted toward the magnet. 'It's a ferromagnetic material. It's iron or steel,' he said. But the brown haze did not move under the magnet. The brown haze was probably an organic material or rock or concrete dust. Lesdiu had separated the dirt into two components - a black dust and a brown haze.
'I've done an autopsy on a terror device,' Lesdiu remarked to Austen.
But now he had reached the end of what was possible with a Reachdeep portable operation. The sample of dust had to go to the F.B.I. metallurgists in Washington, who would continue the analysis. Into the test tube of dust he dropped a strong disinfectant - to sterilize the contents, just in case it contained any live Cobra virus particles. A few minutes later, a Bell turbo helicopter took off for Washington bearing the test tube. The team would have to wait several hours, at least, before the F.B.I. metallurgists could tell what the black dust was. The particles might contain information, but whether that information would constitute a signature that could lead back to the perpetrator, no one knew.
The only part of the boxes not yet studied was the
wooden material of the box itself. James Lesdiu pondered it. He didn't recognize the type of wood. He didn't recognize the design and style of the box, either. It was clearly handmade, and Lesdiu guessed that either Archimedes had made the box himself or that he had bought it at a trinket shop. Reachdeep needed a forensic botanist. Lesdiu called Washington and asked that an expert on wood be flown to Governors Island. Then he photographed the boxes in different kinds of light. He was especially interested in the small pieces of paper that were glued to the boxes. He set up a camera stand and photographed the papers with different kinds of light shining on them. It seemed that the Unsub had been careful to avoid watermarks when cutting the paper. The text itself was from a high-resolution laser printer. The type font was Courier, a common font. While F.B.I. scientists could identify characters from an old-fashioned typewriter, they could not identify laser-printer output. The chemical composition of the paper might lead to a particular manufacturer, but that would probably not be helpful in finding the Unsub.
Every detail of the boxes had been chosen by the Unsub to be hard to trace.
Will Hopkins had set up a series of videoconference meetings with molecular biologists at the Centers for Disease Control and at USAMRIID at Fort Detrick. The experts told him that the Cobra chimera had been built on the most common laboratory strain of baculovirus. It was available through the mail, and it was in use everywhere in the world. The experts told him that they did not know how the virus could be made to replicate explosively in human cells. One of them said to him, 'It's doable. But I just don't know how. The baculovirus is adaptable, and someone's figured out how to adapt it to humans, that's all.'
Mark Littleberry studied James Lesdiu's magnified photographs of the bits of paper glued to the boxes. He was interested in the drawing of a bioreactor that appeared on Harmonica Man's box. He had never seen this exact type of bioreactor before, but in studying the drawing he became convinced that it had been done from life. The drawing had been made by Archimedes using a simple drawing program on a computer, and then it had been shrunk to a tiny size on a laser printer. The drawing was sketchy, but Littleberry believed it had been done by someone who had used a bioreactor and knew exactly how it worked. But who had manufactured the bioreactor? Littleberry and various F.B.I. agents with Masaccio's task force studied sales catalogs and made telephone calls asking about the designs of bioreactors made by companies in the United States. It was not an American design. Littleberry came to suspect - it was a gut feeling, but he couldn't prove it - that the bioreactor came from either an Asian biotechnology company or from perhaps Russia. Tracing it would be very difficult.
The forensic Reachdeep operation was not going as well as Hopkins had hoped. The idea that so many lives might depend on his team's work frightened him. At times he wished he had never joined the F.B.I. Even though he was dog-tired, he found that he couldn't sleep, and he wondered if he was getting an ulcer.
During a discussion of the Unsub's motives, Hopkins suddenly hurried out of the meeting room, and people heard him throwing up in the bathroom. He came out after a while looking shaky. He said that he had been drinking too much coffee. Some of them were afraid he might be getting sick with the virus, but they didn't know what to say or do about it.
'I'm scared for Will,' Littleberry later remarked to Austen. 'I'm wondering if he made promises he can't keep.'
Chimera
Hopkins was thinking about the virus that he and Littleberry had found in Iraq. The drawing of the bioreactor on the cobra box looked somewhat like the bioreactor that he had seen inside the truck in Iraq - at least from what he could remember. The possibility that the deaths in New York were a terrorist event being sponsored by Iraq weighed on him. He discussed it by phone with Frank Masaccio. Masaccio was very disturbed by this. 'If this is terrorism sponsored by a foreign government, Will, this could start a war.'
'I know, Frank,' Hopkins said.
Hopkins put in a call to the Navy's Biological Defense Research Program in Bethesda, where one of his contacts, a Navy doctor named John Letersky, was working through the night. Letersky was a member of the group that supplied Felix equipment to the F.B.I. He had been trying to analyze the chunks of genetic material that Hopkins and Littleberry had beamed up to the satellite when they'd been locked in the rest room.
'Will! How are you doing?' Letersky said.
'The truth is, I'm scared, John. We have a bitch of an investigation that's going nowhere.'
'I'm hearing about it.'
'What can you tell me about the stuff we got in Iraq?' 'It's bad, Will,' Letersky said.
'How bad?'
'Those crystals you swabbed in the truck? Looks like they were Ebola virus crystals. But some of the DNA sequences show similarities to influenza virus. Problem i
s, you didn't get enough DNA. We don't know what the Iraqis were dicking around with in the truck, except that the virus had Ebola in it, and might also have flu in it.'
Hopkins let out a deep breath. There was no apparent connection between the virus in New York and what he had found in Iraq. This made him feel better, for reasons he could not quite articulate.
'So what's the White House going to do about Ebola in Iraq?' he said.
'Nothing. You heard that off the record, okay? Trying to get the White House to pay attention to bioweapons is like pulling teeth. We'll submit a report to the United Nations, and that's as far as it will go. The Iraqis will claim we made a mistake or we're lying, and the White House will drop it. You guys were way outside the limits. We don't have a real sample. And the truck's long gone.' Hopkins went back to work with the Felix machines, and late in the afternoon he had a breakthrough. The following genetic sequence came up on the screen of one of the Felixes:
gaccatattcaggagaaccaaagcccaagac taaaatcccagaaaggcgtgtagtaacacag
It looked no different to Hopkins than any other string of genetic code. The human mind can't read the text of life as easily as it can read Shakespeare. But the GenBank computer could read it. Hopkins got this answer back: Sequences producing High-scoring Segment Pairs:
Human rhinovirus 2 (HRV2) complete n . 310 5.8e-18 1
Human DNA sequence from BAC 322B1 on . . 110 0.53 1
Mus musculus vibrator critical regio. . 107 0.87 1 'Human rhinovirus,' Hopkins muttered. 'Human rhinovirus. The common cold!' He jumped to his feet. 'My God! Cobra's got a piece of the common cold in it!'
He ran to the window of the Core and pounded on the glass. 'Hey, everyone! We've got the common cold!' Hopkins continued picking the genes apart using Felix. He couldn't believe it. It took his breath away. This was impossible. Cobra was partly a common cold. He couldn't figure how it had been mixed with a butterfly virus. It made no sense to him. Somehow the creators of Cobra had managed to make a sticky molecule of some kind on the virus particle that enabled it to grab on to the mucus membranes of the body, especially in the area of the mouth and nose.
Cobra Event Page 20