Kristen’s phone rang before she could reply. She answered. Dave’s voice sailed from the earpiece.
“Kristen, I just returned the boat. You guys okay?”
“Yes, we’re okay.” She relayed to him the ransacking of their room. She could hear Dave quickly relay the news to Tara.
“Jesus. Okay, listen. Agent Shores says she needs to stop by her office but she still wants to talk with you and Lance. How about I pick you up in my truck and we’ll go to my place to check out what’s on the laptop? All my roommates have laptops, I can probably find a cord that’ll work. Agent Shores will meet us there.”
11:33 A.M.
Kristen and Lance squeezed into the front seat of Dave’s pickup truck, Kristen sitting between the two men. A miniature hula girl bobbed and weaved atop the dash. Heading away from the beach as he drove them out of the gridlock of Waikiki and toward the mountains, Dave told them how Agent Shores took the flash-drive to be examined by FBI computer forensics experts. He asked Kristen what she thought the contents of the flash-drive file were. As she explained her DNA encryption theory, the road began to slope upward.
“This is Manoa,” Dave said, indicating a residential neighborhood on their left and a sprawling green lawn on the right. “That’s the University of Hawaii campus, there,” he said, pointing at grassy grounds punctuated by majestic palm trees. “If we kept driving up this road, in a few minutes we’d get to the beginning of the rain forest.”
But he turned off the road and slowed down as he entered a student neighborhood, pedestrians and young adults zipping about on scooters, bicycles and skateboards. He turned into the driveway of a compact one-story house and parked the truck.
The three of them got out and Dave led the way inside to an empty living room. It was all secondhand furniture, electronics and empty beer cans.
“Okay, make yourselves at home, guys. Roommates are either on campus for classes or out working.”
Kristen’s eyes lighted on a clutch of laptops charging on a coffee table. Dave followed her gaze. “Let’s try it,” he said.
Lance wandered past them into the kitchen area and opened the refrigerator. “Mind if I grab one of these beers?” he asked.
“Hair of the dog, eh? Go for it,” Dave said, bending down to examine the power adapters, looking for a match with Kristen’s laptop.
Kristen shook her head. “Really, Lance, don’t you think you had enough last night?”
Lance cracked a can of cheap light beer and looked at his sister. “I’ve been here less than one day and already I’ve been beaten up, shot at, had my wallet stolen and all my stuff destroyed. I need a frickin’ beer.” He proceeded to guzzle his beverage.
Kristen cast him a disapproving glance before handing Dave her laptop. He tried one of the cords, which didn’t fit, before finding a match with the second. “Yeah!” Kristen exclaimed as her machine tasted power once again.
She opened the screen. The mysterious file was still displayed there.
“That does look like something that has to do with DNA and some kind of computer program,” Dave said, squinting at the screen. “Could this be what Johnson was looking for?”
“What else could it be?” Kristen answered. “We didn’t find anything else down there, right?”
Dave nodded in agreement, eyes still on the densely packed characters. “Maybe there’s some info in the file properties, like a name or something,” he suggested.
Kristen raised an eyebrow. “Good idea. Let me check.” She brought up the file’s properties, hoping they might contain some clue as to the document’s origins.
But the properties section was blank.
They heard Lance crack another beer in the kitchen. Dave still appeared doubtful. “I still don’t see how this stuff is worth anything,” he said, tilting his head at the open laptop.
Kristen sighed, shaking her head at the sheaf of papers she had brought that told everything about what had happened to her father...right up to the moment where he disappeared. The activity of the last day began to weigh on her. Sleep was starting to sound good. She lifted her backpack from the floor to put the papers back in, and something fell from it onto the floor.
The collection bottle.
With the excitement of finding the flash-drive, she’d forgotten all about the sample she’d taken during their decompression stop.
She stared at the gray cylinder now laying beneath the laptop.
“Oh, hey, did you get a water sample?” Dave asked, seeing the collection bottle. He was glad to have something to focus on other than the cryptic characters on the screen. He’d been paid good money to take her diving; he wanted her to have something to show for it besides the questionable file.
“Kristen?”
The scientist had not answered him. She stared at the sample bottle, utterly transfixed. He watched her eyes flicker from the bottle to the laptop and back.
“What’s the matter?” Dave prompted.
Kristen picked up the cylinder. She ran a finger along the lid, suddenly interested in the integrity of the seal. She hefted the sampling tool, its weight telling her it contained seawater.
“Dave, can you tell me something?”
“Sure,” he said, perplexed.
“At the university, is there a bioinformatics lab—somewhere that does DNA sequencing?”
…TTCA21TTTG...
University of Hawaii campus
12:41 P.M.
While Dave kept Lance company drinking beers in the house, Kristen struck out in search of a laboratory that could perform DNA sequencing on the marine bacteria present within her sampling bottle. She had a DNA encryption key...where was its lock? Her father had been cataloguing marine bacterial DNA when he went missing. At the very least, she’d be carrying on some of his work, she thought.
At a young looking twenty-eight, wearing shorts and a T-shirt and carrying a backpack, Kristen was easily mistaken for a student as she consulted the campus map Dave had given her. The water sloshing around in the bottle she carried in the pack reminded her, however, that she had more pressing concerns than the typical collegiate responsibilities that once plagued her during her own student days.
She squinted into the sun at the name of a building. A young man removed his iPod earpieces to ask her if she was looking for something. She gave him the name of a hall, and he pointed the way.
She walked through an open archway to a bank of elevators, calling one and riding it to the fourth floor. She exited and walked down an open air hall, checking door numbers as she went. Finding the one that matched what she had on the map, she entered and walked up to a counter occupied by administrative staff. A sign on the wall behind them read, Institute for Genomics, Proteomics and Bioinformatics.
“Student issues are handled by the departmental office, next door,” an Asian woman said, pointing with a pencil without looking up from her computer screen.
Kristen took being mistaken for a student as a compliment. She smiled and said, “Excuse me, my name is Doctor Kristen Archer. I’m a professor of marine microbiology at Cal State University. I’m here to see about having some DNA sequencing work done.”
The secretary looked up, surprised, but recovered quickly. Professors had no dress code, after all.
“Certainly. Have you placed an order already?”
Kristen said that she had not.
“You’ll need to fill out these forms,” she said, handing Kristen a thick stack of papers. Flipping through them, Kristen saw that some were release forms, requiring the person submitting the sample to be sequenced to affirm that the material was not a biological agent on a restricted list, such as microbes that could be weaponized.
Kristen had resigned herself to filling out the extensive paperwork when an elderly Japanese-American man stepped out of a rear office. He wore light slacks and a Hawaiian shirt with muted colors, typical business wear in the islands.
“Did I hear you say you were Kristen Archer? As in William Archer’s da
ughter, and respected scientist in her own right?” He smiled broadly at Kristen, who returned the smile.
“Yes, that’s right—well I’m not sure about the respected part,” she joked, looking up from the forms. “And who might you be?”
“Bruce Watanabe, Director of our humble Institute. I’m terribly sorry to learn about your father’s disappearance. Have you heard any news? Is that what brings you to Hawaii?”
“I came here with my brother to hopefully try and find out what we can about what happened to my father. So far we haven’t turned anything up, but while I’m waiting for the investigation, I thought I might get some work done, so I collected a water sample I’d like to sequence for bacterial DNA.” She had decided it would be best not to mention the DNA encryption key. Kristen frowned at the bulk of paperwork in her lap and smiled up at Dr. Watanabe.
“I wish you the best of luck in the search for your father. He is of course held in the highest esteem by our scientists here at the university. I’m most pleased you came to us for your sequencing needs. I’d be happy to personally handle your request.”
“Thank you. Doctor Watanabe, I’d like to have the bacterial strain with the highest cell counts in this seawater sample sequenced as soon as possible. I can pay extra for rapid processing. Charge it to my research account that I indicated on the form,” she said, tapping the paper in her lap with a pen.
“Certainly, Doctor Archer. I’ll get it to the lab right away. How would you prefer the results be delivered to you? We can express mail a CD-ROM or flash-drive, or e-mail a file...”
“E-mailed file would be the best,” Kristen said. She’d want to be able to get the results from wherever she was when they came back. “How long do you think it will take?”
“As I said, for you, I’ll have them put a rush on it. Say four to eight hours, depending, of course, on the nature of your sample. If you leave me a contact number I’ll call to notify you when the sequencing is complete, or if any problems arise.”
With a last look at her sampling bottle, Kristen handed the vessel over to Dr. Watanabe.
…TTGG22GAAA...
1:25 P.M.
“How’d it go?” Dave asked, welcoming Kristen back into his shared rental house.
“Good,” she said, stepping inside. She told him about the four-to-eight hour wait for the results of the DNA sequencing. Then she saw Lance crashed on the couch.
“Is he okay? How long has he been out?” she asked, approaching her brother.
“He’s okay,” Dave said. “We had a few beers and then he just passed out. Rough night last night.”
Kristen watched the rise and fall of her brother’s chest to make sure he was breathing normally, then turned back to Dave.
“Listen, Dave, I hope we’re not inconveniencing you too much. We can go back to our hotel—”
“No worries. It’s fine, really. Feel free to make yourselves comfortable. My roommates will start coming in around five-thirty, six, and Agent Shores said she'd be stopping by. But listen: watching him sleep made me realize I’m pretty tired, too. I’ve seen a lot of action the last couple days myself. So if you don’t mind, I’m going into my room to take a nap.”
He waved an arm at her laptop, still open on the table. “Feel free to do some work if you want—there’s an internet cable over there somewhere—or if you want I can set up a spare bed for you...”
Kristen eyed her laptop. “Thanks, Dave. I think I’ll have another look at the file while I wait for the sequencing lab to call.”
Dave padded off to his room and shut the door. Kristen pulled a chair up to the laptop table. She woke up her machine. The parade of A’s, C’s, T’s, G’s and one’s and zero’s was there to greet her.
She considered the information on the document’s first and only page. On the boat, she’d had a look at the top group of characters, which seemed to relate four-digit binary strings to two-digit nucleic acid strings. Some kind of binary-genetic conversion, Kristen thought as she looked at it again now. Then she concentrated on the second grouping.
It was different than the first, and much simpler, consisting of only two lines:
GGGGGGGGGGGGGGGGGGGGGGGG
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
Kristen contemplated the simple character strings. G: Guanine. T: Thymine. Both essential building blocks of DNA. But she knew that it would be statistically improbable—no, pretty much impossible, she corrected herself—for so many of the same molecules to occur in a row naturally.
They represented artificially constructed strings—synthetic chains that would have to be engineered in a lab.
She doubted the choice of molecules was an accident, either. The letters themselves were significant. She knew her father would control every nuance of anything he was the architect of—nothing would be left to chance.
Kristen lay her head on the crook of her elbow, resting it on the table. There would have to be a way to know where it was in the DNA string that the coded message began and ended. Otherwise you would have to scan the entire length of DNA for the message, and even for the simplest of organisms, it would take way too long. These long mono-chains seem like logical indicators of where the message started and stopped.
But why G and T?
Then it hit her. Stop thinking of the letters as chemical representations and start thinking of them as letters that make up words...
G: Go.
T: Terminate.
And then, at about the same time as the laptop’s screen went into hibernation mode, Kristen fell asleep.
5:16 P.M.
A cell-phone rang. Kristen’s. Jolted awake by its spastic chirping, the microbiologist glanced about the living room. Her brother still lay snoring on the couch. No one else was in the room. She picked up the phone and hit TALK.
“Good afternoon, Doctor Kristen Archer?”
“Speaking.”
“This is Tomoaki Matsura, from the UH sequencing lab. I’m calling to let you know that we completed the sequencing for your sample, and have e-mailed the results to the address you requested.”
Kristen rubbed her eyes and noted the time on her dive watch. Looking at it now reminded her that the man who had given her this gift was about to be declared dead. It also told her that the sequencing had been completed in just over four hours. Speedy work. Her reputation —and of course her father’s—must carry some weight.
“About how many bacterial strains were present in the sample, and which species is the most prevalent?”
“There are dozens of bacterial species in your sample, Dr. Archer, but by far the most prevalent is Pelagibacter ubique, so that’s the one we sequenced.”
Pelagibacter ubique. Kristen knew that this microbe, as its species name suggested, was quite common in many marine environments. “Okay, thank you very much. If I have any questions about the results, is it alright if I contact you?”
Tomoaki assured her that it was, and she ended the call.
Kristen hunted down the internet connection wire Dave had mentioned and plugged it into her laptop. Online, she went to her web mail account. She downloaded the file from the lab and opened it.
Kristen saw immediately that the results were in what was known in bioinformatics circles as “plain format,” meaning only the nucleic acid characters were represented, with no spaces or other characters. The sequence ran for five pages of single-spaced, densely packed characters. Kristen considered a random selection from the first page:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACCAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGCCTGGAGGGTATGCAGGAAGCGGCAGGAATAAGGCCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG
&
nbsp; AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG…
This was the DNA sequence of the most common bacteria within the sample she’d collected on the dive. By itself, it meant nothing to her. But in combination with the DNA encryption code?
Kristen stared at the sequence. Was there information coded into it worth killing over? She knew that the first step to answering this question would be to search for the START-STOP sequences present in the second half of the key file. If those were in the bacterial DNA sequenced by the lab, then it could only mean that everything in between them had been deliberately inserted as coded information.
It also had to mean, the microbiologist in Kristen mused, that if some string of artificially constructed DNA had been inserted into the natural DNA of a living bacterial cell—and that cell remained viable—that it would have to be put into the so-called “junk DNA” sequences, which were not known to code for any essential life functions.
She copied the START sequence from the key file. “GGGGGGGGGGGGGGGGGGGGGG”. Then she pasted that string of characters into a “Find” window in the sequence file from the lab. Taking a deep breath, she clicked a button that would search the DNA sequence for the START, or “Go” sequence.
Three pages into the five-page sequence, the program highlighted a match.
Kristen slowly exhaled. What if it’s only a coincidence? She went back to the encryption key file, this time copying the STOP, or “Terminate” sequence.
“TTTTTTTTTTTTTTTTTTTTTTTTTTTT.”
She searched for it in the same way against the sequencing results.
Match!
kiDNApped (A Tara Shores Thriller) Page 9