“It’s okay. Just two gay guys, it looks like, taking a stroll away from the crowd. Keep working,” Tara said. Lance chuckled.
Kristen took a deep breath before returning her attention to the screen. She remembered how long it had taken her to decode the first message, sitting there in Dave’s living room, transcribing symbol after symbol. She wasn’t looking forward to repeating the cumbersome process.
“Okay, Lance,” she called out, “I’ve got a job for you that will go toward redeeming yourself.”
She heard him reply from somewhere nearby on the sand. “What is it?”
“A programming job.”
“Go help her,” Tara said. Then Kristen heard the crackle of footsteps, saw the tree branches shake, and then her brother squatted down next to her in front of the computer.
“What have you got?” he asked.
Kristen explained to him the decryption file from the flash drive, and how it worked with the DNA sequence from the lab. “So we know there’s a message deliberately encoded into this DNA sequence,” she finished.
“But last time you manually decoded it, and this time you want me to write a program that automatically parses the file, comparing it to the decrypt key, and writing the translation results to an output file,” Lance said.
Kristen smiled. “Exactly. I’ll leave you to it. Batteries won’t last long, so speed is of the essence.”
“I’m on it,” Lance said. He considered the screen as Kristen parted branches and stepped back out to the beach:
GCAGGAATAAGGCCTGGAGGGTATGCAGGAAGCGGCAGGAATAAGGCC GCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCACCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAAACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCAC CAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGCCTGGAGGGTATGCAGGAAGCGGCAGGAATAAGGCCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCAAGCTCGGGAGGTGGCCAGGCGCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTCCCCAGCAATCCGCGCGCCGGGACAGAATGCCAAGCTCGTTTGGGACCTATATATCCGTTTAAGTTTTTGAATTACAGACCTGAATTACAGACCTGAATTACAGACCTGAATTGAACACATG...
Lance stared at the mind-numbing string of biochemical symbols as his sister had done two days earlier. On and on for ten pages the symbols went. But unlike his sister, he considered the information not from a genetic perspective, but from an automation standpoint. The manual steps Kristen had taken to decode the message contained within the bacterium’s genome were an algorithm, Dave knew—an ordered series of steps—and algorithms could be automated by writing computer code.
In fact, Lance thought as he looked at a diagram Kristen had used to illustrate the decoding steps, it was a relatively simple algorithm. While the underlying concept itself was a sophisticated cross-disciplinary breakthrough, the message decryption procedure could be done using a simple scripting language.
Lance opened a new text file. He set to work writing a script, occasionally pausing to brush bits of plant matter from the keyboard or to smear an insect that dared land on his screen. His broken finger made typing awkward. He could hear Dave and Kristen chatting out on the sand, but he tuned out their presence, focusing on translating Kristen’s decoding process into something the computer could understand. He occasionally paused to wipe sweat from his brow. He was surprised when, nearly forty minutes later, he reached the end of his script and saw how much time had passed.
Taking a deep breath, he executed his new script.
Not that he expected it to work the first time through. He anticipated errors, and there were some. The debugging process was an essential part of programming. But he could see where it was hanging up, and quickly corrected the code. Simple typo’s were responsible in a couple of instances, the result of rapid coding under immense pressure to succeed.
The next time he ran the program, Lance was so pleased to see recognizable English language materialize in the output file that at first he didn’t grasp the meaning of the words.
But as he stared at them, he knew he had done it. His script had automatically processed the genetic letters, comparing thousands of them per second to the patterns in the decryption key, extracting their cryptic message.
And what a message it was.
He yelled for Kristen, Dave and Tara.
…GAAA47CGCC...
11:45 A.M.
“You have the message?” Kristen asked, ducking under the bush. Tara was right behind her while Dave guarded the beach. Lance nodded, angling the laptop’s screen to give them a clear view:
boat Nahoa and CH11 00390 00Q109624343 boat Nahoa and CH11 00390 00Q109624343 boat Nahoa and CH11 00390 00Q109624343 boat Nahoa and CH11 00390 00Q109624343 boat Nahoa…
“Boat Nahoa,” Kristen said, reading aloud. “And what’s that number? The boat registration number?”
Tara shook her head. “No. Not in Hawaii, anyway. Nahoa, that’s obviously Hawaiian, but a Hawaii boat tag would start with the letters HA, which is different from the two-letter state abbreviation of HI.”
“What about the CH?” Lance asked.
“I don’t think there’s any state with the marine abbreviation CH,” Tara said.
“Maybe another country...China?” Kristen suggested.
“I don’t know, but I don’t think there’s too many Chinese boats around here. And why would a Chinese boat be named in Hawaiian?” Dave said.
“Lots of Chinese people live in Hawaii,” Tara stated.
“We should Google this number, and Nahoa,” Kristen said, reaching for the laptop’s wireless switch.
“There won’t be a signal down here,” Tara said, before adding, “Maybe in the visitor center up on the cliff at the entrance, but definitely not down here.”
Kristen tried it anyway.
No signal.
“He’s trying to say he’s being held on a boat called the Nahoa,” Lance said. “I don’t know what that number is either, but it does say ‘and’ between the boat name and the number, like maybe they’re not related.”
“He is supposed to be on a boat, probably a large yacht,” Lance continued. “But these guys were prepared for this in advance. The boat name Dad saw painted on the hull might not be the real registered name. Probably isn’t.”
“It’s still something solid to go on,” Tara said. “Registered or not, if that name is painted on the boat, people might have seen it. It can be found.”
“True,” Lance said. “It’s not something they’d want anyone to know. Hell, they wanted us dead already, just because we found the Tropic Sequence.”
“It’s a twenty-one digit number,” Kristen stated, moving on with the puzzle. They stared at it for a second and then Tara exited the bushes, saying, “We’ve been as productive as we can be here. We need to go online and find out what kind of things are associated with twenty-one digit numbers,” she said as she made her way back out to the beach. “And look up the boat name.”
Kristen snapped the laptop shut and stood.
“It’s a pretty long walk down the beach and up the hill to the parking lot,” Tara said, shading her eyes with a hand. “We should get going.”
Part IV: Mutation
…TCCG48GGGG...
11:50 A.M.
Dr. William Archer had to admit that his kidnappers had done a meticulous job of replicating his shipboard laboratory. It was identical down to the smallest detail—the layout, the lab equipment, the configuration of the benches, the black reflective tile flooring—even the placement of the glassware and the overhead non-glare fluorescent lighting. All of this made it easy to forget that he was not in his own lab.
Until he tried to leave, that is.
The door was locked from the outside. The only porthole was covered with black paint. He was a prisoner; a captive with an assignment: create the GREENBACK carbon dioxide scrubber system, along with supporting documentation which would allow the gene
tically modified organisms to be recreated elsewhere—the lab notes, microscopy images, even video of his procedures.
William Archer tried not to think about how serious these men were—the great lengths they’d gone to in duplicating his custom (and very expensive) shipboard lab, intercepting his yacht (how did they know exactly where and when to be?), murdering his crew, keeping him hidden on a different ship. Dr. Archer had no doubt people would be looking for him, not the least of which would be the kidnap and ransom consultants on retainer at Alacra Genomics, but he wondered how anyone would be able to do anything.
When he was captured—on that chaotic day he could no longer think about without becoming nauseous—he had told the biopirates that a full month was required to create the sought-after microbes. In retrospect, Archer now realized, security had at first been lax. He had been treated almost as an honored guest, albeit one who was not permitted to leave the ship. His requests for contacting the outside world were politely denied by telling him that he would have the opportunity “soon.” His abductors had been satisfied with his thirty-day timeframe and left him to his own devices, not even locking him inside the lab. Archer had taken advantage of that small degree of freedom by using a flash-drive he had been lucky enough to have on his person at the time of capture. The drive contained his DNA encryption scheme. The sole computer in the lab was dedicated for the purpose of controlling machinery and had no connections of any kind, not even ports in which to plug an external storage device like a flash drive, which meant that creating a real message—a typed letter—was impossible. But Archer knew that there was one person in this world who would know what the drive’s single file was: his daughter.
So he had encoded his S.O.S. message into a population of marine microbes and then had his captors deploy the sample in the ocean off Waikiki Beach under the guise of a GREENBACK trial. This part of his plan had gone off without a hitch. It appeared as though Archer was working away in the lab on GREENBACK, when in fact he was transferring his coded message into the junk DNA of marine bacterial cells.
The second part of the plan required that he toss the flash drive overboard. He was lucky enough to find a rugged, watertight plastic box that would float. He placed the flash drive inside and stepped onto the deck just outside his lab. Knowing they were not far off Waikiki, Archer decided that there was a high probability of the box being found. He wished he could have typed a real message, but at least he had something. He had gone missing in this area, and a strange file floating on the ocean…he could only hope that Kristen would hear about it and make the connection.
When he thought no one was looking, Archer had thrown the box overboard. He watched for a moment as it drifted away on the waves, floating like a cork. Pleased with himself, he had retreated to his lab. Fifteen minutes later, one of his kidnappers paid him a visit. In his hand he had held the watertight box. He opened it in front of Archer and took out the flash drive.
“What is on it?” he had asked simply. Archer knew that the man would have checked it on a laptop, but that the file had made no sense to him. Archer told him that the file was part of the original GREENBACK gene sequence work. An early blueprint.
The man surprised him by asking if it would be worth anything to biotechnology companies. Archer said that he was sure it would be considered valuable. He had thought it strange that the man would ask these kinds of questions alone. The kidnapper had then left his lab without saying anything further. It was the last Archer would see of him.
Thirty-five days later a group of kidnappers had burst inside the room, tasers drawn, asking him why he wasn’t yet done with the GREENBACK cell line. “Let me guess. You are unfamiliar with the laboratory,” one of them had joked, eliciting a round of guffaws from his cohorts.
Archer chuckled good naturedly along with them. “In all seriousness, I don’t know why, but the cells died just before the RG16T gene mutated for CO2 uptake. I’ve had this problem before.”
“Then you should know how to fix it,” one of them said.
“I’m working on it.”
And then one of them had walked to a Bunsen burner and lit it, adjusting the flame higher until it burned bright orange. The man had nodded and two of his associates had grabbed Dr. Archer by each arm. He had resisted, his sandaled feet leaving scuff marks on the floor as his captors forcibly dragged him to the burner. They had held his left wrist over the flame as they counted to seven.
“The next time we have to ask why you have not delivered what we requested, the flame will be held to your body for fifteen seconds, and it won’t be your arm—it will be one of your eyes.”
The accomplished scientist had slumped immediately to the floor when the torturers had released their grip on him, clutching his arm in agony, not even realizing he was sobbing in response to a pain that had been unfathomable to him before this day.
“I’d put some ice on that or something,” one of his captors said as they left the lab. “I assume you haven’t forgotten where you keep your first aid kit.”
Thirty days had passed—thirty more long days filled with terrifying uncertainty—during which he slept in a cot in a corner of the lab, listening to the hum of centrifuges working through the night. Funny thing was, he had always kept a cot in his lab at Alacra, so that he could take catnaps during all-night binges of scientific experimentation. But now the cot was his cell bed.
And here they were coming back. William Archer sat calmly on a bench in front of a microscope as he listened to a key sliding into the door lock. He glanced at the deep scar on his wrist before returning his attention to the microscope. He peered into it with one eye as his captors entered the lab, closing the door swiftly behind them so as to offer him as little view as possible of what lay outside “his” lab.
“Progress report,” one of the men demanded.
As usual, the voice was eerily machine-like because all of his captors wore masks with integrated voice modulators, synthesizing a robotic monotone. But what frightened Dr. Archer even more than the masks was the prospect that one time, they might take the masks off, for the day they came to him unmasked would be the day he died, he knew. They wore the masks only so long as they intended to release the scientist.
During his previous month in captivity, Archer had plenty of time to wonder how his release would even be possible. Once they had GREENBACK, what did they have to gain by releasing him? His people at home would no doubt be alert for a ransom call, but he doubted that a simple ransom was the motive for this secretive and highly skilled group.
He made a conscious effort to show no interest whatsoever in identifying his kidnappers. No peering intently at their masks, trying to see through the tinted faceplates, no asking even remotely personal questions, no trying to catch their skin color between the full body coveralls they wore and the yellow rubber gloves. None of that. His K&R training had taught him to let the hostage-takers be as relaxed as possible around him. Let them become accustomed to a docile, compliant captive; cooperative, but not friendly—alert, but not overtly watchful.
But one of the three men was already headed for the Bunsen burner again. And once more, they all carried the tasers. Further proof that they intended to exert complete control over him without resorting to lethal force. But after he gave them what they wanted...
“Gentlemen,” Archer said, inwardly cringing at the use of the word directed at such barbarians, “if you are serious about obtaining GREENBACK, you will have to be a bit more patient. It is not that I’m not working—I am. But just because you place an artificial time constraint on my science does not mean that it will pan out.”
Archer indicated his microscope. “The results of my latest generation are here. It is going to take several more amplification runs. Maybe another week. There is nothing I can do about this timeline.”
“You have documentation for this,” the one by the burner said. A statement, not a question; as if Archer would never be foolish enough not to have documented what he had d
one.
“Of course,” Archer said. “You remember when I released my last experimental population into the ocean.”
“Yes.”
“And then I retrieved the sample—actually you were kind enough to do it for me—”
“You do not need to refresh our memories, doctor. I remind you that you only require one eye to look through your microscope.” The captor at the burner activated the flame, dialing it up, playing with it. That caused the hairs to stand up on Archer’s neck.
“Very well. That population did not exhibit sufficient CO2 uptake. So I will need to release a new population.”
“When?”
“Today. Right now—the sooner the better.”
Archer turned to a Nansen bottle—the same type Kristen had used to collect seawater samples—and held it up. “I will need to release the population in this sample, and then retrieve water and air samples from this same area in seven days. At that time I will examine the cells to verify that their metabolic pathways have been suitably modified for atmospheric CO2 uptake.”
The captor who had been standing in front of the burner approached Archer, standing arm’s length from him. Moving slowly, he reached out and took the Nansen bottle, his breath coming in machine-like rasps through the voice modulator.
“If this procedure is effective,” the captor said, “I trust you will be able to duplicate it.”
“Absolutely. In fact, there’s nothing I want more. As wonderful as these accommodations are, I’m not exactly looking to prolong my stay here.”
There came only the labored, mechanical breathing of the voice modulator.
“During the next week, you have work to do, correct? You will not simply wait for the results of this trial, but will pursue viable alternatives, create action plans for statistically probable outcomes, yes?”
kiDNApped (A Tara Shores Thriller) Page 20