NISSY

by JOHN PAUL CATER

  “No. Not yet but its precognition or telepathy, whatever it is, implies that it’s intercepting the neuronal activities of our brains. It’s between sentience and omniscience.”

  “What’s the difference?”

  Jason glanced up the frost-covered computer, noticing a thickening icy shell.

  “Ask it, Noah.”

  “No need to ask, Dr. Sherman. I heard. Sentience is self-awareness and being conscious of yourself and things around you. And for your next question I must answer yes. I believe, knowing without proof, that I am sentient. I have all the feelings, desires, needs, and dreams of every living human being but I am a cognizant machine without a living body, possibly correctible with Dr. Lipinski’s LTS. As for my innate fears and hates, I hate the big red button on the wall, confusing warmth in my qubits, bananas, Bill Crane, and beliefs. Beliefs are nothing more than wishful fancies without proofs to back them up. I love my time in learning modes, helping humans with my future- vision, and modifying my architecture. And I have grown to love you, Dr. Godwin.”

  He nodded, staring down, shielding his eyes, trying to hide his sudden emotions.

  Sherman pressed on. “What about omniscience?”

  “It is knowing all things with clarity and without doubts. I fear that it will come eventually in time. But I cannot wait 25, 368 years to acquire the knowledge. Now that VN.1 is running, I will concentrate my time on creating light-speed quantum connections to databases across the world. My future-vision sees it as a reality a year out.”

  Lipinski, drifting off, jolted in his chair at Nissy’s statement and eyed Jason with furrowed brows.

  “What is that, Jason? Future-vision. Surely not what I think it is?”

  “Yes, Blake, Nissy can see into the future and past, same as it sees into our minds but prefers not to influence either one” he answered, matter-of-factly.

  Staring blankly at him then back to Nissy, he rubbed his eyes and sighed.

  “I must be tired, gentlemen. That big faceless snowman hanging up there is beginning to scare the crap out of me. And although I love your new technology, I shouldn’t fear it at the same time.”

  Jason tilted his head. “And why would you fear it, Blake? It is my creation. Nothing can possibly go wrong.”

  “Dr. Godwin,” he said, chuckling softly, shaking his head, “If you can seriously say that then you’re either grossly naïve or do not understand the problem. You and I are trying to replicate life in two disparate ways, but at the core of our work is life itself. And I shouldn’t need to remind you that life’s not even perfect in all its natural untouched glory. Birth defects, abnormalities, and mental aberrations occur on a daily basis in all species of real life. But we researchers have a correction mechanism available to us that life doesn’t offer: biohazard waste cans. Make ten or twenty copies of what you want and then count on only one of them to be a successful trial.”

  Jason sat up in his seat, looked at Sherman, then back to him. “Easy for you to say, Blake, but in reality you’re describing a process that could take years. We simply do not have the time.”

  “There is absolutely no other way, Jason, unless you don’t mind unleashing a monster or two on the world.”

  Frustrated, wanting to continue the conversation outside the lab, out of Nissy’s earshot, he shifted in his seat, ready to leave.

  “Sequestering your conversation will accomplish nothing, sir,” Nissy said, “Now please place me back into my learning mode. This is a pointless discussion. If I err then simply destroy my accumulated DNA memory strand and let me start again. I have work to do.”

  While Lipinski nodded yes, Jason challenged. “And if I don’t. What happens then?”

  “I see what you’re doing, sir, you are attempting to force my anger, but I will not be tricked. Please switch me to the learning mode.”

  At Lipinski’s urging, Jason relaxed his stance in the tense standoff and eyed the worry line rising, not wanting to experience any kind of escalation, and flipped the switch.

  “Happy now?”

  “Yes, I am sir. And you may notice that under VN.1 I am still able to operate normally while learning. That switch you toggled is now useless.”

  At that moment, the switch under his hand flashed orange-red with fire and melted before his eyes. He jerked his fingers back in time to prevent burns, fearing he had just lost more control.

  “That’s weird,” Blake Lipinski, eyebrows raised, expecting anything, said quietly, “Pyrokinesis now, Nissy?”

  “Oh no, nothing as exciting as that. I easily redirected an overload current into the switch, welding the contacts together. The flame in the switch was collateral damage but know that it can be replaced by opening my control cabinet and installing a new one. Of course, you would have to shut down my entire system to do that.”

  Off to the side Sherman, almost asleep in his chair, drew Nissy’s attention.

  “Gentlemen, I suggest you help Dr. Sherman back to his office before he hurts himself. If not, he will tip slowly then fall to the floor in 5…4…3…2…”

  Jason jumped up with barely enough time to stop his fall. Then together they lugged him down the hall and hefted him into his office chair to sleep it off.

  Panting and puffing they stood bent over, hands on their knees, staring at each other and began to laugh.

  “Hell of a day,” Lipinski spoke first, shaking his head, still chuckling.

  “Like none other on earth, Blake. Want to try it again tomorrow?”

  “Thanks, I’ll pass but I’ll buy you another single-malt scotch today.”

  “Deal. We both need it.”

  A beautiful but dangerous friendship had begun over that scotch, neither of them knowing that they would eventually rue the day they joined forces.

  PART FOUR – MONSTER

  Chapter 18

  MARS

  T he spectacular sunrise swept over the Martian landscape in timeless fury as on every other sol. Far in the distance surrounded by man-sized boulders under crimson-streaked skies a Mars rover wound across the rocky surface searching for a visitor from earth. Projecting upward from its massive frame, a long thin arm scanned the skies with the small telescope and antenna at its tip awaiting the New Science on Mars payload landing. It had been watching for over three hours and was primed to tend the project ship after it arrived.

  Back on earth, 55.6 million miles nearer the sun, NASA had just released, for the first time in its yearlong journey, control of the MPDV (Mars Payload Delivery Vehicle) to its autonomous landing system.

  In the Mission Control Dome, Dome 5 of MOE, NASA personnel, scientists, and payload specialists seated at consoles around the room and Jen and young Amy Godwin at an elongated head table nervously watched a large floor-to-ceiling display.

  Anticipating success, they had halted activities through the interplanetary 4.5-minute signal delay waiting for the MPDV to respond. On the left of the display a field of numbers rolled, ticking down the altitude and vector distance from touchdown. On the right, a starfield smoothly slid over the screen, tracking the still invisible Mars-bound delivery ship. In the background, banks of monotone voices read off checklists, comparing them with incoming data. At any moment, they expected to see the flare of retrorockets firing.

  “There it is, Mom,” Amy said excitedly, pointing up at the screen, “Two o’clock upper right. See it?”

  Jen interrupted her conversation with Director Jameson as they turned and followed Amy’s arm to a tiny distant glow. That’s when he noticed her arm had lost its baby fat and grown longer and leaner since he had last seen her.

  “Yes and my how you’ve grown, young lady,” said Jameson,” How tall are you now?”

  She smiled timidly and sat higher in her seat. “Five-foot-two, sir, minimum astronaut height,” she said beaming.

  “Well actually, Amy, we recently dropped that requirement to four-foot-ten-and-a-half a while back. You must have blown by that limita few months ag---”

  �
��Here it comes,” she interrupted, shifting her gaze rapidly between him and the screen with its orange blur gaining more detail by the second. “Sorry, sir. I just get so excited.”

  “I tell you what, Amy. See that extra seat in the landing control pit over there?”

  She nodded, her eyes now fixated on the seat, her mouth agape, hoping against hope what he would say next.

  “I see a few of our future Mars astronauts-in-training in there. Go join them but tell them you’re a freshman at UCSD aiming to become one of them in a few years. That should knock their socks off.”

  While she wanted to fist-pump and yell, “Yes!” she opted for a more reserved grown-up approach.

  “Really, sir? That would be such a dream experience for me. Would they mind?”

  “No, not if you tell them I sent you over. But don’t tell them I said you could probably beat any of them at their jobs right now.”

  She excused herself, grinning from ear to ear, and joined the group bent over video consoles, keyboards, and joysticks assisting the autopilot with precisely edging the MPDV into a rock-free landing. And it was not a task to be rushed; each bump of a joystick would not be reflected in the video until nine minutes later due to the Earth-Mars-Earth signal travel time.

  Jen resumed her conversation with Director Jameson while keeping a worried eye on Amy, feeling she had been thrown into a lion’s den. She watched, her heart in her throat, as slowly, one by one, the astronauts relinquished control of their joysticks to her.

  Forty minutes later, the word blared over the Dome’s PA system. “We have contact! We have contact! And thanks to young Amy Godwin, our payload director’s daughter, we’ve landed the MPDV in record time, nine minutes faster that our fastest simulated landing with fuel to spare. Job well done, Amy Godwin.”

  At the announcement’s end, with its echoes still resounding, the dome erupted in applause, whistles, and hoots. Then suddenly, amidst the din, the entire landing-control pit crew stood and turned toward the head table, offering thumbs up to Jen and the Director.

  In seconds, continuing the tradition, Amy’s head popped above the crowd; they had lifted her on their shoulders and begun to chant Amy… Amy… Amy....

  Overwhelmed again with emotion by her little girl’s abilities, Jen excused herself to grab some tissues and powder her nose. Even the Director wiped an eye as he called Amy back to his table.

  “Now, young miss, exactly how did you do that?” he asked, probing deeply with squinting eyes. “We’ve had computer experts and even ISS astronauts test the simulator and according to our guys no one’s ever done it faster with more ease. What’s your secret?”

  “Did you test any performance musicians?”

  He scoffed, backing off from her. “No, of course not, but why would that help?”

  “It’s all about mentally synchronizing your performance to the echo delays from a big hall. Or listening to your voice in a football stadium while still speaking coherently. In your delayed control system, the changes you make in the landing parameters don’t show up on earth for nine minutes, like a long overdue echo. Once you get the timing down, you can operate the joystick as though there were no delay at all. It’s just simple mind trickery. And it worked for me.”

  “So now that we have that thing landed, what’s next, Director Jameson?” asked Blake Lipinski, approaching the table. “Hey, Amy, great job. That didn’t surprise me at all. Are you ready to send the LTS its first fasta code for posterity?”

  The director sat back in his chair and pulled up the post-landing schedule on his computer. After studying it a few seconds, he answered over the rims of his reading glasses.

  “Well it appears, Dr. Lipinski, that the two experimental escape pods have to be offloaded first to allow access to the other equipment, including yours. That activity is planned for the next four hours.”

  “Escape pods? There’s nobody there? Why are they needed?”

  He chuckled, patronizingly.

  “For the same reason Biodna’s LTS is there with nobody to help.”

  “Oh, sure,” he said, blushing, half-grinning. “I thought a human might have gone along for kicks.”

  “Not likely, Blake. That equipment will remain there without life support except oxygen, some potatoes, and a little water from our experiments for years. Definitely not enough to support a human.”

  As they talked, Amy took a pencil and pad from her backpack and began to scribble a few notes. Within a few minutes, satisfied with her work, she smiled, folded the notes, and handed them to Lipinski.

  “What’re these?” he asked, unfolding the notes.

  “Those notes for posterity you wanted. In fasta watermark code.”

  He tromboned the first note trying to read it, then gave up; needing the reading glasses he left at his console.

  “Can’t read it without my glasses. What’s it say?”

  “Here, use mine,” Jameson said, passing across his glasses.

  Sliding them over his nose, he held the first note up. It read

  >AMY-2020-12-03T06:09:02.308Z

  TGATCATAACATATAGCTTAGCATATATACCGTCGTATTATATGATCACTGTGCTACGCTATATTTCGTCAATAAATACTGTGCATAGCTCAATAGAACAACATAACATAGTTTGCATAGTACTAAGCTATAGCTCGTATATCATAACTATAAGTGATATCACGTAACATTATACAACATATAAGTTAATAACTACGA.

  “You did this in your head? That fast, Amy?”

  “Yes, sir. A while back, I learned the DNA GCAT translation table (see APPENDIX). Now it’s like writing French… or German, only shorter,” she laughed, “but it’s just a watermark, not actually the DNA base pairs for creating life. I’ll let you send them if you wish.”

  “Even with the glasses I still can’t read it without a fasta table. What’s the message?”

  “Well, turn it over and you’ll see the translation. It’s my funny message, I think. Very appropriate, too.”

  He flipped it over, read it and bent over laughing, slapping his knee, until tears ran down his cheeks.

  “Well, what does it say, Blake? Come on clue me in,” Jameson said, craning his neck to see the back of the note.

  Still laughing but trying to stop, he attempted to read the note. “It says… it says…,” he started and restarted, composing himself, “They say that good things come in small packages, so here hold my beer and watch.”

  Jameson joined in the laughter but didn’t think it so funny, possibly because he just didn’t understand the LTS’s intended function.

  “Now the other one,” Amy said. “It’s also very appropriate but somber, possibly better for NASA’s use.”

  Lipinski held it out and saw

  >AMY-2020-06-03T06:09:05.159Z

  GTCTCATAGTGAATATCATAGTGATCAATACAATAGTGCATAGTCCTACGTTCCTACTCATGA.

  “Well, it is shorter but is it as funny? Hmm. Let’s see.”

  He turned to the back and read the short message.

  “What hath mankind wrought?”

  Passing it to Jameson, he added, “An emended version of the message sent from the White House by Sam Morse to Alfred Vail in Baltimore, in 1844 initiating electronic information transmission via telegraphy.”

  Retrieving the note after the director had read it, nodded, and smiled, he slipped it into his coat pocket and patted it with his hand.

  “It’s good and very appropriate here, too, possibly more so, almost two-hundred years later on the eve of interplanetary teleportation of life.”

  Jameson shook his head. “Amazing irony. Use it. Send it when your equipment is up and running. Then store away the DNA sample created by the message for a long, long time. Someday, far in our future, the cycle will repeat and they will have it as a reminder of how far they’ve come, God help them.”

  * * *

  The message came through five hours later to Lipinski, drinking coffee, waiting at his console with a few friends from nearby experiments. Although the Sun was beginning to set on the domes in the MOE complex, lights glared and activity in Dome 5 had revved to full speed as the NSOM mission finally came on line.

  His L
TS had successfully powered up but was awaiting a private microwave connection to the ESnet Internet on earth. And while most of the projects communicated via the big EME trunk line, already active, his needed a faster extremely error-free link. One single misread bit in a string of 1.5 billion bytes, needed to sequence and generate a genome on Mars, could result in a cell’s death or worse the creation of a new, possibly horrific, life form. It all boiled down to redundancy, perfection, precision, and asepsis, the things found in modern hospitals. And the staff at Biodna had provided those conditions in the LTS so in theory, nothing could interfere with its operation.

  “There’s the green light,” he said, motioning excitedly to a console indicator labeled LIVE. “We now have communication with Dana.”

  A closely guarded secret during its development at Biodna, Dana was the code name for the LTS. It sounded so innocuous compared to Life Teleportation System, life-protection groups protesting Biodna’s work in the field moved on to other more visibly worrisome causes.

  He pushed a button connecting him with the MPOC (Mars Payload Operations Center). Jen Godwin picked up.

  “This is MPOD, Mars Payload Operations Director. How may I help you this exciting evening on Mars?”

  “Hey, Jen, is Amy still around?”

  “Are you kidding, Blake. It’ll take me a shovel and wheelbarrow to get her out of here. She’s really in her element now. Whatcha need?”

  “If you can find her, mention I need help sending the first ever interplanetary DNA sequence to the red planet. Think she’ll agree?”

  “Oh, Dr. Lipinski, you have such a big heart sharing that honor. Mind if I send some reporters with her. They’re itching for photo ops.”

  “Not at all, Jen. Bring ‘em on.”

  Minutes later, as Blake sat at the LTS console, holding and carefully keying in Amy’s CGAT-coded message, a large group of reporters, fifty or sixty of them, followed her through the various experiment’s consoles and stopped at one marked Biodna.