The Boy Who Wasn't Short

by Kirk, Edwin;

  The HGP took a logical, safe approach to sequencing the genome, taking what was known as ‘walks’ from known to unknown places. But they had a competitor — J. Craig Venter, the Elon Musk of genomics, who proposed a different approach altogether. Venter wanted to use a shotgun to get the job done.

  Venter was a brilliant scientist with an entrepreneurial streak. After a less than stellar school career, from which he emerged a better surfer than scholar, Venter was drafted, and he served in the United States Navy during the Vietnam war. Experiences in a field hospital had a profound effect on him, and, when he returned, he studied medicine, but later switched to research. He proved an outstanding scientist, but, while working for the National Institutes of Health, became involved in a controversy over efforts to patent genes, and later left the NIH to go to the private sector — where he also excelled. As the first president of Celera Corporation, he decided to race the Human Genome Project, using a method the HGP had rejected — shotgun sequencing. This involves smashing the genome up into many small pieces, sequencing those, and then assembling them like a giant jigsaw puzzle.

  Let’s say you do some sequencing and find that you have three fragments like this:

  GGTGTGAACTGCCCCGAGGG

  CCGAGGGCAGAGACCTCCCGTTTTG

  CGTTTTGTTCTCCAGCGCCTTGAGCCAGC

  With the right computing oomph behind you, it’s possible to put these together, like this:

  GGTGTGAACTGCCCCGAGGGCAGAGACCTC

  CCGTTTTGTTCTCCAGCGCCTTGAGCCAGC8

  [8 Another non-randomly chosen sequence: this is from NKX2-5, which also featured in my PhD and is one of my favourites for another reason. Animal geneticists in general, and fly geneticists in particular, have always been much better than human geneticists at naming genes. NKX2-5 is important in the development of the human heart. Flies don’t have much of a heart — just a tube that squeezes, really — but they have a gene that is very similar to NKX2-5. When that gene was found, it was discovered that flies that lack the gene don’t develop their tube-heart at all. The name of the fly gene? Tinman.]

  The first chunk overlaps with the second, and the second with the third. Without the second, you’d have no way of connecting the first with the third. But keep on smashing and sequencing, smashing and sequencing, and eventually you’ll have enough overlapping bits that you can put the whole thing together. And in a genuinely astonishing achievement, Celera did exactly that. Pitted against 20 institutes in six countries and the US Department of Energy, Celera crossed the finish line in lockstep with the public HGP, which is why Venter shared the floor with Collins that day at the White House.

  Celera did have one important advantage over the HGP — access to all of the public body’s data. From the beginning, one of the fundamental principles of the HGP was open access to data, setting the tone for a standard that continues in biomedical science to this day.

  You may wonder what Celera hoped to gain by this effort. The initial plan was to discover and patent genetic sequences. Celera did file preliminary patents on 6,500 gene sequences, but in the end did not follow through with the patent process, and made their data freely available as well (including sending us the disk that, through no fault of theirs, we couldn’t interpret).

  Even from the beginning, the ‘reference’ human genome was a mishmash of the genomes of different people — as it should be. The HGP called for volunteers from people living near the 20 sequencing centres. No personally identifying information was kept, and only a small proportion of the samples collected were actually used for sequencing, so nobody knows whose DNA is the ‘reference’. The ‘reference’ genome we work with today has been updated and adjusted using extra information from many different people; it’s a quilt made from many patches of cloth of varying sizes. Celera did something along the same lines, although perhaps less random. Twenty-one donors were enrolled. Apart from age, sex, and ethnic background (self-described), no information was kept about them. The volunteers had to provide 130 mL of blood (a little over a quarter of a pint, enough to make for quite a vivid crime scene). Males also provided five specimens of semen, collected over a six-week period (the section of Celera’s Science paper that describes their methods is strangely interesting). Of the 21 volunteers, just five people were chosen for sequencing. Two men and three women; one African American, one Chinese, one Hispanic Mexican, and two Caucasians.

  It turned out later that one of the Caucasians, a male, contributed disproportionately to the effort, and was no longer anonymous: it was Venter himself. Only a few years later, Venter had the remainder of his genome sequenced, possibly the first individual human being to have this done. ‘Possibly’ because, at around the same time, James Watson had his genome sequenced, and it’s not clear which was finished first.

  That was in 2007. At the time, sequencing an individual human’s genome was an astonishing idea. Now, it’s almost commonplace — you can have your own genome sequenced, if you have a few thousand dollars to spare and the inclination to do it. Hundreds of thousands of people have had their genome sequenced already.

  A few thousand dollars? It cost about three billion US dollars for the Human Genome Project to produce the first-draft human genome sequence. It has been estimated that, in 2001, it would have been possible to sequence an individual human genome for about US$100,000,000. The cost has come down at a remarkable rate as the technology has advanced. Now, it’s possible to sequence a human genome for (notionally) less than $1,000 … and the cost is still falling. Analysing the data is already more of a challenge than generating the sequence. To put the fall in costs into context, imagine that sequencing a genome was a brand-new Lamborghini, retailing at $428,000. If Lamborghinis were to come down in price to the same degree that sequencing a genome has done, you’d now be able to pick up your shiny new car at the bargain basement price of $4.30.

  Got a few bucks? Let’s take this baby for a spin!

  3

  The boy who wasn’t short

  You will never make a crab walk straight.

  ARISTOPHANES

  Different people are prone to different types of mistake. I’m particularly vulnerable to the mistake that underlies much of magic. Magicians rely, in part, on misdirection — guiding your gaze over there so you don’t notice something important that’s happening right here. In medicine, misdirection can come from other doctors, from the patient, or just from unlucky happenstance, and it tends to lead to what look like simple mistakes — errors you would never make if you were paying attention to the right thing.

  If the magician’s art is to misdirect us, the art of medicine often lies in finding ways not to be misdirected. We talk about ‘traps for young players’ — but the truth is that old players can also be ensnared.

  A few years ago, a general practitioner, not a young player, referred a small boy to me for investigation of short stature. This was a bit unusual, because most of the time such referrals go to a paediatrician first. Then they might go to an endocrinologist, a specialist in hormones, including those that direct growth. But there are many genetic conditions that can make a child short, so, although unusual, it wasn’t an unreasonable thought to ask a geneticist’s opinion. In this case, the story was quite worrying, because there had been a rapid crossing of centile lines.

  Paediatricians track children’s growth using centile charts. These are graphs that show normal growth patterns, with lines representing different percentiles. Three per cent of children are taller than the 97th percentile for height. A quarter of children are shorter than the 25th centile for height. Half of all children are lighter than the 50th centile for weight. And so on. Most children, most of the time, grow along a particular line. Start small, relative to other babies — you will probably continue to be small.

  The neat thing about centile charts for growth is that you can very easily use them to track whether things are progressing normally or not. Does that baby have a big head pur
ely because he’s from a family who take large hat sizes, and is destined to do the same? Then he should track along the same centile line over time. Is his head crossing lines upwards? That might be a problem. Cross enough lines and he will most likely score a brain scan. Similarly, when someone has been on a particular track for height and then drops — like the boy in this story — that’s a worry, and it makes us sit up and pay attention. Growing is one of the most important things that children do, and, when they stop doing it, it’s important to find out why. It’s not that this child had shrunk, of course — more that he had grown one centimetre over a period when we would have expected him to grow seven.

  I went through the usual process we follow with any new patient. I asked about the boy’s family and their heights. I found out about the pregnancy, about his birth and early development. I examined him, looking particularly for abnormal limbs, for disproportion between limbs and body. I looked at the creases on the palms of his hands, because, if the bones in your hands are short, the creases can form differently.

  I found nothing. Not a thing. He was a completely normal-looking child, who to all intents and purposes had been doing fine — until his growth went off a cliff.

  So I went back to the growth chart. Fortunately, his mother had brought in his ‘Blue Book’, a book new parents are given for recording health information about their child. Even more fortunately, there were several previous height measurements in the book. I plotted them on the growth chart — and the answer jumped out at me.

  Every measurement throughout his life had placed this child a little below the 25th centile for height — except for the one that someone had done nine months earlier, which had him above the 90th centile. In retrospect, it was obvious that that measurement had been a mismeasurement: the boy had not plummeted from the 90th to below the 25th centile, because he had never been on the 90th in the first place.

  The boy wasn’t short, and certainly didn’t need to see a geneticist. But I didn’t count this appointment as a waste of time. And in the long run, neither did the boy’s mother, because that referral may have saved her life.

  *

  When I was a medical student, cancer was a mysterious thing. Not that we were completely ignorant — far from it. We knew that there were plenty of things that could give you cancer. Smoking, of course. Asbestos. Certain viruses, such as HIV. Exposure to mustard gas, fortunately not a common problem nowadays. In Australia, melanoma heartland of the world (Come visit! You’ll love it here!) … the sun.

  We even knew that there were some inherited types of cancer, and there was evidence as far back as the late 1950s that there were genetic changes in cancer cells. In particular, in 1959, two researchers in Philadelphia (Peter Nowell and David Hungerford) noticed that, in some leukaemia cells, chromosome 22 was abnormally short; it was named the Philadelphia chromosome. In 1973, Janet Rowley1 discovered that the reason for the short chromosome 22 was that part of the chromosome had broken off, and was stuck onto chromosome 9. This turned out to be enormously important, because it was the first of a whole class of chromosome abnormalities uncovered in cancer.

  [1 Just a few weeks after Rowley’s discovery, Margaret Garson (a cytogeneticist in Melbourne) independently found the same thing. The two were friends, and the story told in Australia is that, when Rowley found out about Garson’s findings, she graciously offered to publish their findings together; but Garson declined, saying that Rowley had beaten her to it and deserved the credit.]

  Many years later, the reason why this rearrangement of two chromosomes was a part of causing cancer was identified. The places where the two chromosomes break are in the middle of two different genes. Their fusion makes a new, hyperactive gene that drives abnormal cell growth. This discovery led in turn to the creation of a group of new treatments for some types of cancer (called tyrosine kinase inhibitors).

  Over the past few decades, the biology of cancer has been worked out, in ever greater detail. It turns out that cancer is almost entirely a disease of the genome. The sickness that afflicts the genome of a cancer cell boils down to one thing: a mismatch between the accelerator and the brakes of the cell.

  Growth is a fundamental part of life. At conception, you were a single cell. It was a huge cell, as cells go, about as wide as a strand of hair — but still a tiny, tiny thing. One of the most important tasks that cell had was to grow. As it divided and divided, signals were sent to the machinery of the new daughter cells, urging them to multiply and expand. These signals were obeyed, and, thanks to the rich bath of nutrients your mother provided, they were obeyed with gusto.

  Which was fine — until it wasn’t. At some point, it’s not enough to be an ever-expanding ball of cells. You needed a shape. You needed some parts to grow, while others stopped. You even needed some cells to die. Six weeks after conception, you weighed about 500 times as much as when you were just a fertilised egg. If you’d continued growing at that rate, you’d have weighed more than the Earth before your first birthday.

  This means that, to balance that first rush of acceleration, your cells also needed brakes. They needed a lot more than that, because all sorts of decisions had to be made. Which end is the top, and which is the bottom? Which side is the left, and which is the right? There are a pair of genes, named LEFTY1 and LEFTY2,2 that hold part of the answer to that one. Once you have a top and a bottom and a left and a right, you also have a front and a back. You’re still little more than a blob at this point, but you’re on your way.

  [2 Yes, there should be a gene called RIGHTY. But there isn’t. The closest I can offer is a gene that’s important for the midline of your body, called MID1.]

  There’s a beautiful complexity to what happens next. Proteins signal to each other in a kind of dance; instructions are sent to cells telling them their fate. You, and all your daughters, will be skin cells. You will be a nerve cell. You will be a liver cell. Grow along this line. Stop growing when you reach this point. Start doing your job, whatever it is: contracting, to make the heart beat; firing electrical signals, to make the brain work; filtering blood, to clean it and make urine.

  But for some cells, the message reads: you will die. This is important in all sorts of ways — there is a process called programmed cell death, a pruning that takes out cells that aren’t needed. One of the places this is easiest to imagine is in the limbs. Your arm started out as a little nub, then grew to be a flipper. Your hand started as a lump on the end of the flipper. To make fingers, the cells in the gaps between the fingers had to go away — and so they did.

  The message telling a cell that it needs to die is important later in life, too. Cells that are sick or damaged can trigger their own destruction. If this didn’t happen, a sick cell could cause problems by using up resources, by poisoning its neighbours, or by just getting in the way. Or by transforming into a cancer cell.

  So there are three types of signal. Grow — the accelerators. Stop growing — the brakes. And the signal to die. All of these need to be in balance, and the balance is different for each cell type. In fact, for many individual cells, the brakes are locked fully on. Once a cell gets to be a mature white blood cell, for instance, by and large it is never supposed to divide again. Once it wears out, it has to be replaced by stem cells in your bone marrow. Stem cells hover around, not fully formed into a specialised cell but waiting until they are needed — at which point they divide, and one of the daughter cells matures into the needed blood cell (or liver cell or muscle cell, as the case may be) and the other steps back into the wings, waiting until it is needed again. Some other kinds of mature cell (such as skin cells) keep the ability to divide and replace themselves.

  In some parts of the body (cartilage, brain), cells last a long time and seldom need replacement. Elsewhere, there is a great deal of wear and tear. Skin cells and the lining of your gut are constantly shearing off and being replaced. Rapid growth and replacement of cells creates opportunities
for things to go wrong, which is one of the reasons skin cancer and bowel cancer are so common.

  Every time a cell divides, its DNA has to be copied. Two sets of three billion pieces of information, copied out in the space of a few hours, in a tiny, tiny space. Mistakes get made. They get made all the time. Mostly, they are caught in time by the genome’s fact checkers, and are fixed. But there are plenty of chances for the fact checkers to get it wrong. A typical human body is made up of perhaps 30 trillion cells (30,000,000,000,000).3 In the course of an average lifetime, that might mean around ten quadrillion cell divisions (10,000,000,000,000,000). That’s a lot more than the number of cells, because of the many divisions needed to go from fertilised egg to adult, and because of all of the replacing of dead cells that has to happen.

  [3 That’s just the human cells, of course — you are host to so many bacteria, protozoa, and fungi that there are about as many non-human as human cells in your body. Most of them are tiny, so at least the human part outweighs everything else. You probably woke up this morning thinking you were a human being, and you were only about 3 per cent wrong. Ninety-seven per cent human: not so bad.

  It’s not just single-celled organisms, by the way. When I was at university, we had a lecturer who claimed that we have so many worms in our guts that, instead of saying ‘good morning’ to people, we should say, ‘How are your nematodes today?’

  If that thought bothers you, I suggest you don’t look up face mites. No, really — forget I ever mentioned them.

  Sorry.]

  How many mistakes get missed? Well, if you’re typical, you have between 40 and 80 changes in your DNA, in every cell of your body, that you didn’t get from the genome of either parent, but will pass on to your children. Most of those had their origin in your father’s sperm. Making sperm is a high-speed, high-volume, and comparatively low-quality exercise compared with the bespoke tailoring that goes into making an egg.